Incidental Mutation 'R0083:Ccdc88a'
ID19765
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Namecoiled coil domain containing 88A
SynonymsGirdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0083 (G1)
Quality Score197
Status Validated
Chromosome11
Chromosomal Location29373658-29510808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29503463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 337 (S337T)
Ref Sequence ENSEMBL: ENSMUSP00000114942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000140194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040182
AA Change: S1609T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: S1609T

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123561
AA Change: S589T
SMART Domains Protein: ENSMUSP00000119173
Gene: ENSMUSG00000032740
AA Change: S589T

DomainStartEndE-ValueType
coiled coil region 1 212 N/A INTRINSIC
coiled coil region 248 365 N/A INTRINSIC
low complexity region 418 425 N/A INTRINSIC
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140194
AA Change: S337T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114942
Gene: ENSMUSG00000032740
AA Change: S337T

DomainStartEndE-ValueType
coiled coil region 3 85 N/A INTRINSIC
low complexity region 137 144 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29499341 missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29424772 missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29501046 missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29503915 missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29400283 missense probably benign
IGL01647:Ccdc88a APN 11 29504321 unclassified probably benign
IGL02648:Ccdc88a APN 11 29501051 missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29448050 missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29374559 missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29482340 missense possibly damaging 0.56
trailor UTSW 11 29494099 splice site probably null
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0108:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29461021 missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29461042 unclassified probably benign
R0631:Ccdc88a UTSW 11 29493752 missense probably damaging 0.98
R0632:Ccdc88a UTSW 11 29482749 unclassified probably benign
R0762:Ccdc88a UTSW 11 29463112 unclassified probably benign
R0838:Ccdc88a UTSW 11 29400285 missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29456509 missense probably benign
R1192:Ccdc88a UTSW 11 29504049 missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29482713 missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29477427 missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29489637 missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29503480 missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29463546 nonsense probably null
R2284:Ccdc88a UTSW 11 29494099 splice site probably null
R3236:Ccdc88a UTSW 11 29447995 missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29448033 missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29430227 missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29463399 missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4518:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29482241 missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29422586 missense probably benign
R4707:Ccdc88a UTSW 11 29447956 missense probably benign
R4732:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29482720 missense probably benign
R4749:Ccdc88a UTSW 11 29482720 missense probably benign
R4817:Ccdc88a UTSW 11 29460907 missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29463210 missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29482133 nonsense probably null
R5288:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29463279 missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29503484 missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29482663 missense probably benign 0.01
R7116:Ccdc88a UTSW 11 29504051 missense probably benign 0.01
R7353:Ccdc88a UTSW 11 29463368 missense probably benign 0.00
R7538:Ccdc88a UTSW 11 29463370 missense probably benign 0.00
R7663:Ccdc88a UTSW 11 29498614 critical splice donor site probably null
R7769:Ccdc88a UTSW 11 29482381 missense probably damaging 1.00
R7798:Ccdc88a UTSW 11 29477348 missense probably benign 0.15
R7810:Ccdc88a UTSW 11 29485964 missense probably damaging 1.00
R7826:Ccdc88a UTSW 11 29503563 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGTGGTATCCAGTTGTTATACTGAGG -3'
(R):5'- TCTTTCCCCAGAAAGTCGGAAGACA -3'

Sequencing Primer
(F):5'- CCAGTTGTTATACTGAGGAACAAG -3'
(R):5'- CTCCTAAGGTTCAGTTACAATGC -3'
Posted On2013-04-11