Incidental Mutation 'R1468:Pikfyve'
ID 197674
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
MMRRC Submission 039521-MU
Accession Numbers

Genbank: NM_011086

Essential gene? Essential (E-score: 1.000) question?
Stock # R1468 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65251666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1215 (Y1215H)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1215H

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1215H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097707
AA Change: Y1260H

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1260H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.4921 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65265789 missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65246395 missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65253342 splice site probably benign
R8307:Pikfyve UTSW 1 65245735 missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65215996 missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65244417 missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65271268 missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65246970 missense probably benign 0.00
R8995:Pikfyve UTSW 1 65205587 critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65244400 missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65246080 missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65196739 missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65260029 missense probably benign 0.37
R9368:Pikfyve UTSW 1 65268742 missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65264402 missense probably benign
R9605:Pikfyve UTSW 1 65264402 missense probably benign
R9686:Pikfyve UTSW 1 65252456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGAGGTAAAACCTGTTCCACAGC -3'
(R):5'- AAACTGATGTCGAGGTGCCCCAAG -3'

Sequencing Primer
(F):5'- CCTGTTCCACAGCATCATTAGATATG -3'
(R):5'- cagatctatgtgagttccagacc -3'
Posted On 2014-05-23