Incidental Mutation 'R1468:Brinp3'
ID197678
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Namebone morphogenetic protein/retinoic acid inducible neural specific 3
SynonymsFam5c, B830045N13Rik
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location146494760-146902472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146901962 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 716 (P716T)
Ref Sequence ENSEMBL: ENSMUSP00000126074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
Predicted Effect probably benign
Transcript: ENSMUST00000074622
AA Change: P716T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: P716T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166814
AA Change: P716T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: P716T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3918:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7375:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7412:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATCTACCTGAGGAGTCGCATC -3'
(R):5'- ATGCACAAAAGCATTGCCACGG -3'

Sequencing Primer
(F):5'- AGTTTATTGACCCATCCCGGAAC -3'
(R):5'- GTGTGTAAATTGCCATCCAACG -3'
Posted On2014-05-23