Mutagenetix > Incidental Mutation

Incidental Mutation 'R1468:Itgav'

197685

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

039521-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1468 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 83765901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably benign
Transcript: ENSMUST00000028499

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111740

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.6%
20x: 90.1%

Validation Efficiency

98% (106/108)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	G	7: 12,512,580	M1R	probably null	Het
4933440N22Rik	C	A	6: 117,907,579		probably benign	Het
5031439G07Rik	G	T	15: 84,953,144	P280T	probably damaging	Het
Abca2	C	T	2: 25,441,296	S1267L	probably damaging	Het
Acsl3	A	T	1: 78,706,409	R719S	probably benign	Het
Adam1a	A	T	5: 121,519,776		probably null	Het
Adamts7	T	C	9: 90,188,798		probably benign	Het
Adgrf3	G	A	5: 30,202,229		probably benign	Het
Aldh6a1	T	C	12: 84,441,770	E89G	possibly damaging	Het
Ankrd36	A	G	11: 5,575,752	Y238C	probably damaging	Het
Ankrd65	G	A	4: 155,792,905	R291Q	probably benign	Het
Ano2	C	T	6: 125,796,264	R287W	probably damaging	Het
Ap1ar	A	G	3: 127,812,566	I125T	probably benign	Het
Arid1b	A	G	17: 5,242,922	D705G	probably damaging	Het
Asb18	T	A	1: 89,996,283	N86I	probably damaging	Het
Bicral	A	T	17: 46,824,593	S564T	probably benign	Het
Bpifa6	A	G	2: 153,989,272	M253V	probably benign	Het
Braf	T	C	6: 39,665,083	D194G	probably damaging	Het
Brinp3	C	A	1: 146,901,962	P716T	probably benign	Het
C7	T	A	15: 5,012,149	Y425F	probably damaging	Het
Ccdc102a	T	C	8: 94,906,086	K421R	probably benign	Het
Cep89	G	A	7: 35,420,963		probably null	Het
Chgb	A	T	2: 132,792,800	M221L	probably benign	Het
Chst14	A	G	2: 118,927,664	Y313C	probably damaging	Het
Ciita	G	A	16: 10,513,288		probably null	Het
Clec12b	A	T	6: 129,380,640	I85N	probably damaging	Het
Clec2e	G	T	6: 129,093,496	Y187*	probably null	Het
Crbn	T	C	6: 106,790,843	K229E	probably benign	Het
Ctdspl2	A	T	2: 121,981,281	Q201L	probably benign	Het
Ctrb1	G	T	8: 111,689,409		probably benign	Het
Cyp2c55	T	A	19: 39,011,081	V77E	probably damaging	Het
Cyp2c69	A	C	19: 39,849,395	D414E	probably damaging	Het
Ddx47	T	C	6: 135,011,740		probably benign	Het
Dlg1	A	G	16: 31,842,822		probably null	Het
Dnah5	C	A	15: 28,230,463	S169*	probably null	Het
Dock4	C	A	12: 40,755,810	T927K	probably benign	Het
Esrp2	T	G	8: 106,133,821	D259A	probably damaging	Het
Fam169a	A	G	13: 97,118,530	K418R	probably benign	Het
Fam207a	A	G	10: 77,497,526		probably benign	Het
Fancm	A	T	12: 65,099,293	I597F	probably damaging	Het
Fastkd2	G	T	1: 63,732,226		probably benign	Het
Fat1	G	A	8: 45,010,545	V1375M	probably damaging	Het
Fbxw10	A	T	11: 62,862,638	D486V	probably damaging	Het
Fech	C	T	18: 64,470,673		probably benign	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Foxp1	T	A	6: 98,978,220	H195L	possibly damaging	Het
Gfra1	T	A	19: 58,451,975	I138L	probably benign	Het
Gm12185	T	C	11: 48,915,674	D230G	possibly damaging	Het
Gm14403	T	A	2: 177,507,231		probably benign	Het
Gpd2	A	C	2: 57,355,774	T439P	probably damaging	Het
Gpm6a	A	T	8: 55,037,350	K20N	probably damaging	Het
Hc	A	T	2: 34,983,807	Y158*	probably null	Het
Hectd4	A	T	5: 121,349,172	D3410V	possibly damaging	Het
Il17b	G	A	18: 61,690,412		probably null	Het
Irx4	G	T	13: 73,265,576	R55L	possibly damaging	Het
Lama3	T	C	18: 12,441,107	V582A	probably benign	Het
Ldhd	G	T	8: 111,627,293	A425E	possibly damaging	Het
Lrp1b	C	T	2: 40,927,829		probably null	Het
Lrp5	T	C	19: 3,620,191	T638A	possibly damaging	Het
Lrrk1	A	C	7: 66,259,974	F1996C	probably damaging	Het
Ly6h	G	A	15: 75,566,137	S21L	probably benign	Het
Mctp1	T	C	13: 76,825,273	V431A	probably benign	Het
Metap2	C	T	10: 93,871,483		probably null	Het
Mfsd2b	T	A	12: 4,870,536	K94*	probably null	Het
Micall2	A	G	5: 139,719,342	L79P	probably damaging	Het
Mucl2	T	C	15: 103,897,407	T95A	possibly damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Myo5b	G	T	18: 74,740,503	V1467L	probably damaging	Het
Nfic	G	T	10: 81,420,580	D105E	probably damaging	Het
Nrd1	T	A	4: 109,016,668	F227Y	probably benign	Het
Nrp2	A	T	1: 62,738,299	I88F	probably damaging	Het
Nup160	A	T	2: 90,700,543	H515L	probably benign	Het
Nup205	G	A	6: 35,225,982		probably null	Het
Oas1g	G	A	5: 120,882,006	T179I	probably benign	Het
Ogfr	A	T	2: 180,594,750	E376V	probably damaging	Het
Olfr1212	T	G	2: 88,959,043	Y192*	probably null	Het
Olfr1241	A	T	2: 89,482,511	V208D	possibly damaging	Het
Olfr166	T	G	16: 19,487,628	S263R	probably benign	Het
Olfr478	C	T	7: 108,032,388		probably null	Het
Olfr646	G	T	7: 104,106,689	V137F	possibly damaging	Het
Pard3b	T	C	1: 62,345,029	V851A	probably benign	Het
Pcdhb16	A	T	18: 37,478,089	Y34F	probably damaging	Het
Pikfyve	T	C	1: 65,251,666	Y1215H	probably damaging	Het
Pkhd1	A	T	1: 20,523,341	V1516E	probably damaging	Het
Pla2g4a	A	T	1: 149,887,593		probably benign	Het
Ptprg	A	T	14: 12,190,767	I818F	probably benign	Het
Ralgapb	A	G	2: 158,462,253	E644G	possibly damaging	Het
Rbm45	A	G	2: 76,372,115	I127M	probably damaging	Het
Rtp2	T	C	16: 23,927,470	Y157C	probably damaging	Het
Sema3f	A	T	9: 107,687,572		probably benign	Het
Sf3b3	A	T	8: 110,837,374	Y329N	probably damaging	Het
Sfxn1	A	G	13: 54,085,627		probably null	Het
Shkbp1	A	T	7: 27,345,326	C447S	probably damaging	Het
Sipa1l3	A	G	7: 29,322,260	S689P	possibly damaging	Het
Slc7a8	A	G	14: 54,733,199	S332P	probably damaging	Het
Slit1	C	A	19: 41,608,384	C1092F	probably damaging	Het
Stard9	A	G	2: 120,703,197	I619V	possibly damaging	Het
Sycp3	T	C	10: 88,469,592	V185A	possibly damaging	Het
Taar9	A	T	10: 24,109,484	N17K	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,988	E102G	probably damaging	Het
Tex44	A	G	1: 86,427,112	N248D	probably benign	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tnpo1	C	T	13: 98,850,157	V781I	probably benign	Het
Tonsl	C	T	15: 76,636,561		probably null	Het
Ttc6	A	G	12: 57,674,677	K984R	possibly damaging	Het
Usp34	A	G	11: 23,441,171	E2263G	probably damaging	Het
Usp8	A	G	2: 126,754,927	K875E	probably damaging	Het
Vapb	C	T	2: 173,762,112		probably benign	Het
Vmn1r223	A	G	13: 23,249,868	I211V	possibly damaging	Het
Vmn2r81	G	A	10: 79,293,662	V796I	probably damaging	Het
Wdr90	A	T	17: 25,854,053	V856D	probably damaging	Het
Wnk2	T	A	13: 49,082,095	T615S	probably damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGAAGGCACCACTCTGAAGTTCCC -3'
(R):5'- AAAACGCCTCAGCCGTGACTTG -3'

Sequencing Primer
(F):5'- CCCTTGAGAGGGCTATTTCAC -3'
(R):5'- TCAGCCGTGACTTGGTACAG -3'

Posted On

2014-05-23