Incidental Mutation 'R1468:Stard9'
ID 197690
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name StAR related lipid transfer domain containing 9
Synonyms 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R1468 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120459602-120562376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120533678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 619 (I619V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000070420
AA Change: I619V

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705
AA Change: I619V

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180041
AA Change: I3312V

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: I3312V

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,246,507 (GRCm39) M1R probably null Het
4933440N22Rik C A 6: 117,884,540 (GRCm39) probably benign Het
5031439G07Rik G T 15: 84,837,345 (GRCm39) P280T probably damaging Het
Abca2 C T 2: 25,331,308 (GRCm39) S1267L probably damaging Het
Acsl3 A T 1: 78,684,126 (GRCm39) R719S probably benign Het
Adam1a A T 5: 121,657,839 (GRCm39) probably null Het
Adamts7 T C 9: 90,070,851 (GRCm39) probably benign Het
Adgrf3 G A 5: 30,407,227 (GRCm39) probably benign Het
Aldh6a1 T C 12: 84,488,544 (GRCm39) E89G possibly damaging Het
Ankrd36 A G 11: 5,525,752 (GRCm39) Y238C probably damaging Het
Ankrd65 G A 4: 155,877,362 (GRCm39) R291Q probably benign Het
Ano2 C T 6: 125,773,227 (GRCm39) R287W probably damaging Het
Ap1ar A G 3: 127,606,215 (GRCm39) I125T probably benign Het
Arid1b A G 17: 5,293,197 (GRCm39) D705G probably damaging Het
Asb18 T A 1: 89,924,005 (GRCm39) N86I probably damaging Het
Bicral A T 17: 47,135,519 (GRCm39) S564T probably benign Het
Bpifa6 A G 2: 153,831,192 (GRCm39) M253V probably benign Het
Braf T C 6: 39,642,017 (GRCm39) D194G probably damaging Het
Brinp3 C A 1: 146,777,700 (GRCm39) P716T probably benign Het
C7 T A 15: 5,041,631 (GRCm39) Y425F probably damaging Het
Ccdc102a T C 8: 95,632,714 (GRCm39) K421R probably benign Het
Cep89 G A 7: 35,120,388 (GRCm39) probably null Het
Chgb A T 2: 132,634,720 (GRCm39) M221L probably benign Het
Chst14 A G 2: 118,758,145 (GRCm39) Y313C probably damaging Het
Ciita G A 16: 10,331,152 (GRCm39) probably null Het
Clec12b A T 6: 129,357,603 (GRCm39) I85N probably damaging Het
Clec2e G T 6: 129,070,459 (GRCm39) Y187* probably null Het
Crbn T C 6: 106,767,804 (GRCm39) K229E probably benign Het
Ctdspl2 A T 2: 121,811,762 (GRCm39) Q201L probably benign Het
Ctrb1 G T 8: 112,416,041 (GRCm39) probably benign Het
Cyp2c55 T A 19: 38,999,525 (GRCm39) V77E probably damaging Het
Cyp2c69 A C 19: 39,837,839 (GRCm39) D414E probably damaging Het
Ddx47 T C 6: 134,988,703 (GRCm39) probably benign Het
Dlg1 A G 16: 31,661,640 (GRCm39) probably null Het
Dnah5 C A 15: 28,230,609 (GRCm39) S169* probably null Het
Dock4 C A 12: 40,805,809 (GRCm39) T927K probably benign Het
Esrp2 T G 8: 106,860,453 (GRCm39) D259A probably damaging Het
Fam169a A G 13: 97,255,038 (GRCm39) K418R probably benign Het
Fancm A T 12: 65,146,067 (GRCm39) I597F probably damaging Het
Fastkd2 G T 1: 63,771,385 (GRCm39) probably benign Het
Fat1 G A 8: 45,463,582 (GRCm39) V1375M probably damaging Het
Fbxw10 A T 11: 62,753,464 (GRCm39) D486V probably damaging Het
Fech C T 18: 64,603,744 (GRCm39) probably benign Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Foxp1 T A 6: 98,955,181 (GRCm39) H195L possibly damaging Het
Gfra1 T A 19: 58,440,407 (GRCm39) I138L probably benign Het
Gm12185 T C 11: 48,806,501 (GRCm39) D230G possibly damaging Het
Gm14403 T A 2: 177,199,024 (GRCm39) probably benign Het
Gpd2 A C 2: 57,245,786 (GRCm39) T439P probably damaging Het
Gpm6a A T 8: 55,490,385 (GRCm39) K20N probably damaging Het
Hc A T 2: 34,873,819 (GRCm39) Y158* probably null Het
Hectd4 A T 5: 121,487,235 (GRCm39) D3410V possibly damaging Het
Il17b G A 18: 61,823,483 (GRCm39) probably null Het
Irx4 G T 13: 73,413,695 (GRCm39) R55L possibly damaging Het
Itgav A T 2: 83,596,245 (GRCm39) probably benign Het
Lama3 T C 18: 12,574,164 (GRCm39) V582A probably benign Het
Ldhd G T 8: 112,353,925 (GRCm39) A425E possibly damaging Het
Lrp1b C T 2: 40,817,841 (GRCm39) probably null Het
Lrp5 T C 19: 3,670,191 (GRCm39) T638A possibly damaging Het
Lrrk1 A C 7: 65,909,722 (GRCm39) F1996C probably damaging Het
Ly6h G A 15: 75,437,986 (GRCm39) S21L probably benign Het
Mctp1 T C 13: 76,973,392 (GRCm39) V431A probably benign Het
Metap2 C T 10: 93,707,345 (GRCm39) probably null Het
Mfsd2b T A 12: 4,920,536 (GRCm39) K94* probably null Het
Micall2 A G 5: 139,705,097 (GRCm39) L79P probably damaging Het
Mucl2 T C 15: 103,927,673 (GRCm39) T95A possibly damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Myo5b G T 18: 74,873,574 (GRCm39) V1467L probably damaging Het
Nfic G T 10: 81,256,414 (GRCm39) D105E probably damaging Het
Nrdc T A 4: 108,873,865 (GRCm39) F227Y probably benign Het
Nrp2 A T 1: 62,777,458 (GRCm39) I88F probably damaging Het
Nup160 A T 2: 90,530,887 (GRCm39) H515L probably benign Het
Nup205 G A 6: 35,202,917 (GRCm39) probably null Het
Oas1g G A 5: 121,020,069 (GRCm39) T179I probably benign Het
Ogfr A T 2: 180,236,543 (GRCm39) E376V probably damaging Het
Or2l13 T G 16: 19,306,378 (GRCm39) S263R probably benign Het
Or4a69 A T 2: 89,312,855 (GRCm39) V208D possibly damaging Het
Or4c107 T G 2: 88,789,387 (GRCm39) Y192* probably null Het
Or52d1 G T 7: 103,755,896 (GRCm39) V137F possibly damaging Het
Or5p6 C T 7: 107,631,595 (GRCm39) probably null Het
Pard3b T C 1: 62,384,188 (GRCm39) V851A probably benign Het
Pcdhb16 A T 18: 37,611,142 (GRCm39) Y34F probably damaging Het
Pikfyve T C 1: 65,290,825 (GRCm39) Y1215H probably damaging Het
Pkhd1 A T 1: 20,593,565 (GRCm39) V1516E probably damaging Het
Pla2g4a A T 1: 149,763,344 (GRCm39) probably benign Het
Ptprg A T 14: 12,190,767 (GRCm38) I818F probably benign Het
Ralgapb A G 2: 158,304,173 (GRCm39) E644G possibly damaging Het
Rbm45 A G 2: 76,202,459 (GRCm39) I127M probably damaging Het
Rtp2 T C 16: 23,746,220 (GRCm39) Y157C probably damaging Het
Sema3f A T 9: 107,564,771 (GRCm39) probably benign Het
Sf3b3 A T 8: 111,564,006 (GRCm39) Y329N probably damaging Het
Sfxn1 A G 13: 54,239,646 (GRCm39) probably null Het
Shkbp1 A T 7: 27,044,751 (GRCm39) C447S probably damaging Het
Sipa1l3 A G 7: 29,021,685 (GRCm39) S689P possibly damaging Het
Slc7a8 A G 14: 54,970,656 (GRCm39) S332P probably damaging Het
Slit1 C A 19: 41,596,823 (GRCm39) C1092F probably damaging Het
Slx9 A G 10: 77,333,360 (GRCm39) probably benign Het
Sycp3 T C 10: 88,305,454 (GRCm39) V185A possibly damaging Het
Taar9 A T 10: 23,985,382 (GRCm39) N17K possibly damaging Het
Tbkbp1 T C 11: 97,039,814 (GRCm39) E102G probably damaging Het
Tex44 A G 1: 86,354,834 (GRCm39) N248D probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tnpo1 C T 13: 98,986,665 (GRCm39) V781I probably benign Het
Tonsl C T 15: 76,520,761 (GRCm39) probably null Het
Ttc6 A G 12: 57,721,463 (GRCm39) K984R possibly damaging Het
Usp34 A G 11: 23,391,171 (GRCm39) E2263G probably damaging Het
Usp8 A G 2: 126,596,847 (GRCm39) K875E probably damaging Het
Vapb C T 2: 173,603,905 (GRCm39) probably benign Het
Vmn1r223 A G 13: 23,434,038 (GRCm39) I211V possibly damaging Het
Vmn2r81 G A 10: 79,129,496 (GRCm39) V796I probably damaging Het
Wdr90 A T 17: 26,073,027 (GRCm39) V856D probably damaging Het
Wnk2 T A 13: 49,235,571 (GRCm39) T615S probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,532,328 (GRCm39) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,528,960 (GRCm39) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,529,200 (GRCm39) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,531,849 (GRCm39) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,536,808 (GRCm39) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,504,085 (GRCm39) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,533,811 (GRCm39) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,529,565 (GRCm39) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,536,927 (GRCm39) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,498,497 (GRCm39) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,532,820 (GRCm39) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,495,391 (GRCm39) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,527,388 (GRCm39) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,529,473 (GRCm39) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,544,288 (GRCm39) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,526,566 (GRCm39) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,532,675 (GRCm39) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,533,237 (GRCm39) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,527,916 (GRCm39) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0038:Stard9 UTSW 2 120,526,313 (GRCm39) missense probably benign
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,464,736 (GRCm39) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,526,788 (GRCm39) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,528,077 (GRCm39) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,529,404 (GRCm39) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,529,028 (GRCm39) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,536,787 (GRCm39) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,529,738 (GRCm39) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,531,323 (GRCm39) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,526,304 (GRCm39) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,523,920 (GRCm39) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,535,650 (GRCm39) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,523,331 (GRCm39) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,526,694 (GRCm39) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,543,929 (GRCm39) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,527,958 (GRCm39) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,543,328 (GRCm39) splice site probably benign
R1416:Stard9 UTSW 2 120,531,453 (GRCm39) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,496,857 (GRCm39) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,532,533 (GRCm39) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,527,192 (GRCm39) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,528,156 (GRCm39) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,534,203 (GRCm39) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,532,023 (GRCm39) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,529,973 (GRCm39) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,531,970 (GRCm39) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,509,934 (GRCm39) splice site probably null
R1847:Stard9 UTSW 2 120,528,970 (GRCm39) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,519,232 (GRCm39) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,524,189 (GRCm39) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,526,908 (GRCm39) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,544,293 (GRCm39) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,529,137 (GRCm39) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,531,887 (GRCm39) missense probably benign
R1999:Stard9 UTSW 2 120,523,349 (GRCm39) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,495,426 (GRCm39) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,534,716 (GRCm39) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,532,879 (GRCm39) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,544,601 (GRCm39) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,529,012 (GRCm39) frame shift probably null
R2422:Stard9 UTSW 2 120,530,765 (GRCm39) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,534,170 (GRCm39) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,544,030 (GRCm39) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,528,710 (GRCm39) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,534,636 (GRCm39) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,532,427 (GRCm39) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,464,703 (GRCm39) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,528,272 (GRCm39) missense probably benign
R4499:Stard9 UTSW 2 120,530,722 (GRCm39) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,526,926 (GRCm39) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,529,121 (GRCm39) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,536,194 (GRCm39) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,526,604 (GRCm39) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,526,422 (GRCm39) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,533,594 (GRCm39) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,531,341 (GRCm39) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,536,900 (GRCm39) nonsense probably null
R5033:Stard9 UTSW 2 120,523,880 (GRCm39) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,527,500 (GRCm39) nonsense probably null
R5157:Stard9 UTSW 2 120,528,342 (GRCm39) missense probably benign
R5213:Stard9 UTSW 2 120,529,707 (GRCm39) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,529,839 (GRCm39) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,535,568 (GRCm39) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,532,428 (GRCm39) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,529,626 (GRCm39) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,529,711 (GRCm39) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,533,387 (GRCm39) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,524,149 (GRCm39) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,535,803 (GRCm39) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,534,267 (GRCm39) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,533,877 (GRCm39) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,531,851 (GRCm39) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,544,039 (GRCm39) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,530,442 (GRCm39) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,527,580 (GRCm39) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,537,375 (GRCm39) missense probably damaging 0.99
R6012:Stard9 UTSW 2 120,535,067 (GRCm39) missense probably damaging 1.00
R6019:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6020:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,524,135 (GRCm39) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,527,241 (GRCm39) missense probably damaging 0.99
R6228:Stard9 UTSW 2 120,544,231 (GRCm39) missense probably damaging 1.00
R6235:Stard9 UTSW 2 120,544,027 (GRCm39) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,531,608 (GRCm39) missense probably benign
R6338:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign
R6344:Stard9 UTSW 2 120,534,801 (GRCm39) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,543,910 (GRCm39) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,496,888 (GRCm39) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,526,253 (GRCm39) missense probably benign 0.11
R6747:Stard9 UTSW 2 120,528,864 (GRCm39) missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120,531,740 (GRCm39) missense probably damaging 1.00
R6836:Stard9 UTSW 2 120,530,324 (GRCm39) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,535,667 (GRCm39) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,544,549 (GRCm39) nonsense probably null
R6875:Stard9 UTSW 2 120,527,917 (GRCm39) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,533,111 (GRCm39) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,528,176 (GRCm39) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,532,677 (GRCm39) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,527,672 (GRCm39) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,530,931 (GRCm39) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,509,859 (GRCm39) nonsense probably null
R7151:Stard9 UTSW 2 120,526,623 (GRCm39) missense probably benign
R7154:Stard9 UTSW 2 120,535,023 (GRCm39) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,531,795 (GRCm39) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,534,639 (GRCm39) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,537,419 (GRCm39) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,464,755 (GRCm39) nonsense probably null
R7282:Stard9 UTSW 2 120,528,984 (GRCm39) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,535,167 (GRCm39) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,497,015 (GRCm39) missense probably benign
R7359:Stard9 UTSW 2 120,528,761 (GRCm39) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,495,483 (GRCm39) splice site probably null
R7410:Stard9 UTSW 2 120,531,978 (GRCm39) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,532,633 (GRCm39) missense probably benign 0.21
R7475:Stard9 UTSW 2 120,518,591 (GRCm39) missense probably damaging 1.00
R7523:Stard9 UTSW 2 120,530,078 (GRCm39) missense probably benign
R7553:Stard9 UTSW 2 120,524,289 (GRCm39) splice site probably null
R7624:Stard9 UTSW 2 120,518,627 (GRCm39) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,529,860 (GRCm39) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,531,465 (GRCm39) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,532,587 (GRCm39) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,534,146 (GRCm39) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,534,942 (GRCm39) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,526,562 (GRCm39) missense not run
R7956:Stard9 UTSW 2 120,535,852 (GRCm39) nonsense probably null
R8013:Stard9 UTSW 2 120,518,582 (GRCm39) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R8117:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,530,529 (GRCm39) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,535,250 (GRCm39) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,532,270 (GRCm39) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,510,306 (GRCm39) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,545,140 (GRCm39) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,533,796 (GRCm39) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,531,595 (GRCm39) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,534,059 (GRCm39) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,510,442 (GRCm39) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,535,212 (GRCm39) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,535,932 (GRCm39) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,535,943 (GRCm39) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,534,099 (GRCm39) missense probably benign
R8920:Stard9 UTSW 2 120,533,088 (GRCm39) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,536,283 (GRCm39) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,508,415 (GRCm39) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,510,418 (GRCm39) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,529,068 (GRCm39) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,533,500 (GRCm39) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,528,447 (GRCm39) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R9393:Stard9 UTSW 2 120,518,656 (GRCm39) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,495,414 (GRCm39) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,534,714 (GRCm39) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,526,635 (GRCm39) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,510,417 (GRCm39) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,533,444 (GRCm39) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,533,225 (GRCm39) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,528,803 (GRCm39) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,527,093 (GRCm39) missense probably benign
Z1176:Stard9 UTSW 2 120,526,299 (GRCm39) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,504,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCAGCTCATCTCGGTCTCTTCAAG -3'
(R):5'- AACCAAAGTGCAGCATTTCTTCGTC -3'

Sequencing Primer
(F):5'- ATTTGAGTGTGGAACCTCCATC -3'
(R):5'- TCGTCCGTCTGAGAATGC -3'
Posted On 2014-05-23