Incidental Mutation 'R1468:Hectd4'
ID197705
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121349172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 3410 (D3410V)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: D3410V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: D3410V

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCAAGCCTGAGGACATGCTG -3'
(R):5'- TCTGTGAGACACACTGTGAACTGC -3'

Sequencing Primer
(F):5'- GACATGCTGTGGTTCCACC -3'
(R):5'- TCCAGGCTGTCCACACTG -3'
Posted On2014-05-23