Incidental Mutation 'R1468:Braf'
ID 197709
Institutional Source Beutler Lab
Gene Symbol Braf
Ensembl Gene ENSMUSG00000002413
Gene Name Braf transforming gene
Synonyms Braf-2, D6Ertd631e, 9930012E13Rik, Braf2
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1468 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 39603237-39725463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39665083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 194 (D194G)
Ref Sequence ENSEMBL: ENSMUSP00000099036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]
AlphaFold P28028
Predicted Effect possibly damaging
Transcript: ENSMUST00000002487
AA Change: D195G

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: D195G

DomainStartEndE-ValueType
low complexity region 5 30 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 94 121 N/A INTRINSIC
RBD 139 211 1.04e-33 SMART
C1 219 264 1.05e-13 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 316 326 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
Pfam:Pkinase_Tyr 494 751 9.6e-65 PFAM
Pfam:Pkinase 494 753 5.1e-60 PFAM
Pfam:Kinase-like 573 741 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101497
AA Change: D194G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: D194G

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
coiled coil region 60 88 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
RBD 138 210 1.04e-33 SMART
C1 218 263 1.05e-13 SMART
low complexity region 296 310 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
low complexity region 406 421 N/A INTRINSIC
Pfam:Pkinase 441 698 8.2e-62 PFAM
Pfam:Pkinase_Tyr 441 698 1.5e-65 PFAM
Pfam:Kinase-like 523 688 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169647
Meta Mutation Damage Score 0.2436 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Braf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Braf APN 6 39660999 splice site probably null
IGL01616:Braf APN 6 39651652 missense probably damaging 1.00
IGL01621:Braf APN 6 39646853 intron probably benign
IGL01825:Braf APN 6 39639590 missense probably damaging 0.99
IGL02435:Braf APN 6 39646766 missense probably benign 0.00
IGL02629:Braf APN 6 39688299 missense possibly damaging 0.83
IGL02751:Braf APN 6 39660867 splice site probably benign
IGL02829:Braf APN 6 39627728 missense possibly damaging 0.62
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0497:Braf UTSW 6 39640549 splice site probably benign
R0512:Braf UTSW 6 39664989 splice site probably benign
R0604:Braf UTSW 6 39623697 missense probably damaging 1.00
R0726:Braf UTSW 6 39662148 missense possibly damaging 0.90
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1616:Braf UTSW 6 39643133 missense probably benign 0.35
R2160:Braf UTSW 6 39662073 missense probably damaging 1.00
R3722:Braf UTSW 6 39623676 missense probably damaging 1.00
R4407:Braf UTSW 6 39615720 missense probably damaging 1.00
R4540:Braf UTSW 6 39644333 missense probably damaging 1.00
R5026:Braf UTSW 6 39688287 missense probably benign 0.22
R5478:Braf UTSW 6 39677574 missense possibly damaging 0.94
R6284:Braf UTSW 6 39688282 missense possibly damaging 0.73
R6993:Braf UTSW 6 39643163 missense probably damaging 1.00
R7251:Braf UTSW 6 39677570 critical splice donor site probably null
R7385:Braf UTSW 6 39665108 critical splice acceptor site probably null
R7483:Braf UTSW 6 39627838 missense possibly damaging 0.86
R7511:Braf UTSW 6 39688253 missense probably damaging 0.99
R7660:Braf UTSW 6 39623641 missense possibly damaging 0.48
R8323:Braf UTSW 6 39643124 missense possibly damaging 0.83
R8527:Braf UTSW 6 39627759 missense probably benign 0.37
R8542:Braf UTSW 6 39627759 missense probably benign 0.37
R8993:Braf UTSW 6 39662151 missense probably damaging 0.99
R9573:Braf UTSW 6 39623610 missense probably damaging 1.00
R9689:Braf UTSW 6 39614150 missense probably damaging 0.99
Z1088:Braf UTSW 6 39662026 missense probably damaging 1.00
Z1176:Braf UTSW 6 39643182 missense probably damaging 1.00
Z1186:Braf UTSW 6 39725253 missense unknown
Z1186:Braf UTSW 6 39725255 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAAGTACGCTGTGCTCACTG -3'
(R):5'- AAACCCCAGGAACAATTTGGTTTTGAC -3'

Sequencing Primer
(F):5'- AGAGAACTATCCTGTTACCTGC -3'
(R):5'- CAGGAACAATTTGGTTTTGACTGTTG -3'
Posted On 2014-05-23