Incidental Mutation 'R1468:Esrp2'
ID 197726
Institutional Source Beutler Lab
Gene Symbol Esrp2
Ensembl Gene ENSMUSG00000084128
Gene Name epithelial splicing regulatory protein 2
Synonyms 9530027K23Rik, Rbm35b
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1468 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106856951-106863606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 106860453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 259 (D259A)
Ref Sequence ENSEMBL: ENSMUSP00000123114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000115979] [ENSMUST00000146940]
AlphaFold Q8K0G8
Predicted Effect probably benign
Transcript: ENSMUST00000109308
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115979
AA Change: D260A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111639
Gene: ENSMUSG00000084128
AA Change: D260A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 248 320 2.58e-1 SMART
RRM 349 424 2.67e-2 SMART
low complexity region 439 459 N/A INTRINSIC
RRM 466 541 4.17e-3 SMART
low complexity region 549 575 N/A INTRINSIC
low complexity region 593 614 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139559
Predicted Effect probably damaging
Transcript: ENSMUST00000146940
AA Change: D259A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123114
Gene: ENSMUSG00000084128
AA Change: D259A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 247 319 2.58e-1 SMART
RRM 348 423 2.67e-2 SMART
low complexity region 438 458 N/A INTRINSIC
RRM 465 540 4.17e-3 SMART
low complexity region 548 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150527
Meta Mutation Damage Score 0.2346 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR2 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Homozygous null mice exhibit defects in hepatic maturation, and decreased serum albumin levels and total serum protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,246,507 (GRCm39) M1R probably null Het
4933440N22Rik C A 6: 117,884,540 (GRCm39) probably benign Het
5031439G07Rik G T 15: 84,837,345 (GRCm39) P280T probably damaging Het
Abca2 C T 2: 25,331,308 (GRCm39) S1267L probably damaging Het
Acsl3 A T 1: 78,684,126 (GRCm39) R719S probably benign Het
Adam1a A T 5: 121,657,839 (GRCm39) probably null Het
Adamts7 T C 9: 90,070,851 (GRCm39) probably benign Het
Adgrf3 G A 5: 30,407,227 (GRCm39) probably benign Het
Aldh6a1 T C 12: 84,488,544 (GRCm39) E89G possibly damaging Het
Ankrd36 A G 11: 5,525,752 (GRCm39) Y238C probably damaging Het
Ankrd65 G A 4: 155,877,362 (GRCm39) R291Q probably benign Het
Ano2 C T 6: 125,773,227 (GRCm39) R287W probably damaging Het
Ap1ar A G 3: 127,606,215 (GRCm39) I125T probably benign Het
Arid1b A G 17: 5,293,197 (GRCm39) D705G probably damaging Het
Asb18 T A 1: 89,924,005 (GRCm39) N86I probably damaging Het
Bicral A T 17: 47,135,519 (GRCm39) S564T probably benign Het
Bpifa6 A G 2: 153,831,192 (GRCm39) M253V probably benign Het
Braf T C 6: 39,642,017 (GRCm39) D194G probably damaging Het
Brinp3 C A 1: 146,777,700 (GRCm39) P716T probably benign Het
C7 T A 15: 5,041,631 (GRCm39) Y425F probably damaging Het
Ccdc102a T C 8: 95,632,714 (GRCm39) K421R probably benign Het
Cep89 G A 7: 35,120,388 (GRCm39) probably null Het
Chgb A T 2: 132,634,720 (GRCm39) M221L probably benign Het
Chst14 A G 2: 118,758,145 (GRCm39) Y313C probably damaging Het
Ciita G A 16: 10,331,152 (GRCm39) probably null Het
Clec12b A T 6: 129,357,603 (GRCm39) I85N probably damaging Het
Clec2e G T 6: 129,070,459 (GRCm39) Y187* probably null Het
Crbn T C 6: 106,767,804 (GRCm39) K229E probably benign Het
Ctdspl2 A T 2: 121,811,762 (GRCm39) Q201L probably benign Het
Ctrb1 G T 8: 112,416,041 (GRCm39) probably benign Het
Cyp2c55 T A 19: 38,999,525 (GRCm39) V77E probably damaging Het
Cyp2c69 A C 19: 39,837,839 (GRCm39) D414E probably damaging Het
Ddx47 T C 6: 134,988,703 (GRCm39) probably benign Het
Dlg1 A G 16: 31,661,640 (GRCm39) probably null Het
Dnah5 C A 15: 28,230,609 (GRCm39) S169* probably null Het
Dock4 C A 12: 40,805,809 (GRCm39) T927K probably benign Het
Fam169a A G 13: 97,255,038 (GRCm39) K418R probably benign Het
Fancm A T 12: 65,146,067 (GRCm39) I597F probably damaging Het
Fastkd2 G T 1: 63,771,385 (GRCm39) probably benign Het
Fat1 G A 8: 45,463,582 (GRCm39) V1375M probably damaging Het
Fbxw10 A T 11: 62,753,464 (GRCm39) D486V probably damaging Het
Fech C T 18: 64,603,744 (GRCm39) probably benign Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Foxp1 T A 6: 98,955,181 (GRCm39) H195L possibly damaging Het
Gfra1 T A 19: 58,440,407 (GRCm39) I138L probably benign Het
Gm12185 T C 11: 48,806,501 (GRCm39) D230G possibly damaging Het
Gm14403 T A 2: 177,199,024 (GRCm39) probably benign Het
Gpd2 A C 2: 57,245,786 (GRCm39) T439P probably damaging Het
Gpm6a A T 8: 55,490,385 (GRCm39) K20N probably damaging Het
Hc A T 2: 34,873,819 (GRCm39) Y158* probably null Het
Hectd4 A T 5: 121,487,235 (GRCm39) D3410V possibly damaging Het
Il17b G A 18: 61,823,483 (GRCm39) probably null Het
Irx4 G T 13: 73,413,695 (GRCm39) R55L possibly damaging Het
Itgav A T 2: 83,596,245 (GRCm39) probably benign Het
Lama3 T C 18: 12,574,164 (GRCm39) V582A probably benign Het
Ldhd G T 8: 112,353,925 (GRCm39) A425E possibly damaging Het
Lrp1b C T 2: 40,817,841 (GRCm39) probably null Het
Lrp5 T C 19: 3,670,191 (GRCm39) T638A possibly damaging Het
Lrrk1 A C 7: 65,909,722 (GRCm39) F1996C probably damaging Het
Ly6h G A 15: 75,437,986 (GRCm39) S21L probably benign Het
Mctp1 T C 13: 76,973,392 (GRCm39) V431A probably benign Het
Metap2 C T 10: 93,707,345 (GRCm39) probably null Het
Mfsd2b T A 12: 4,920,536 (GRCm39) K94* probably null Het
Micall2 A G 5: 139,705,097 (GRCm39) L79P probably damaging Het
Mucl2 T C 15: 103,927,673 (GRCm39) T95A possibly damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Myo5b G T 18: 74,873,574 (GRCm39) V1467L probably damaging Het
Nfic G T 10: 81,256,414 (GRCm39) D105E probably damaging Het
Nrdc T A 4: 108,873,865 (GRCm39) F227Y probably benign Het
Nrp2 A T 1: 62,777,458 (GRCm39) I88F probably damaging Het
Nup160 A T 2: 90,530,887 (GRCm39) H515L probably benign Het
Nup205 G A 6: 35,202,917 (GRCm39) probably null Het
Oas1g G A 5: 121,020,069 (GRCm39) T179I probably benign Het
Ogfr A T 2: 180,236,543 (GRCm39) E376V probably damaging Het
Or2l13 T G 16: 19,306,378 (GRCm39) S263R probably benign Het
Or4a69 A T 2: 89,312,855 (GRCm39) V208D possibly damaging Het
Or4c107 T G 2: 88,789,387 (GRCm39) Y192* probably null Het
Or52d1 G T 7: 103,755,896 (GRCm39) V137F possibly damaging Het
Or5p6 C T 7: 107,631,595 (GRCm39) probably null Het
Pard3b T C 1: 62,384,188 (GRCm39) V851A probably benign Het
Pcdhb16 A T 18: 37,611,142 (GRCm39) Y34F probably damaging Het
Pikfyve T C 1: 65,290,825 (GRCm39) Y1215H probably damaging Het
Pkhd1 A T 1: 20,593,565 (GRCm39) V1516E probably damaging Het
Pla2g4a A T 1: 149,763,344 (GRCm39) probably benign Het
Ptprg A T 14: 12,190,767 (GRCm38) I818F probably benign Het
Ralgapb A G 2: 158,304,173 (GRCm39) E644G possibly damaging Het
Rbm45 A G 2: 76,202,459 (GRCm39) I127M probably damaging Het
Rtp2 T C 16: 23,746,220 (GRCm39) Y157C probably damaging Het
Sema3f A T 9: 107,564,771 (GRCm39) probably benign Het
Sf3b3 A T 8: 111,564,006 (GRCm39) Y329N probably damaging Het
Sfxn1 A G 13: 54,239,646 (GRCm39) probably null Het
Shkbp1 A T 7: 27,044,751 (GRCm39) C447S probably damaging Het
Sipa1l3 A G 7: 29,021,685 (GRCm39) S689P possibly damaging Het
Slc7a8 A G 14: 54,970,656 (GRCm39) S332P probably damaging Het
Slit1 C A 19: 41,596,823 (GRCm39) C1092F probably damaging Het
Slx9 A G 10: 77,333,360 (GRCm39) probably benign Het
Stard9 A G 2: 120,533,678 (GRCm39) I619V possibly damaging Het
Sycp3 T C 10: 88,305,454 (GRCm39) V185A possibly damaging Het
Taar9 A T 10: 23,985,382 (GRCm39) N17K possibly damaging Het
Tbkbp1 T C 11: 97,039,814 (GRCm39) E102G probably damaging Het
Tex44 A G 1: 86,354,834 (GRCm39) N248D probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tnpo1 C T 13: 98,986,665 (GRCm39) V781I probably benign Het
Tonsl C T 15: 76,520,761 (GRCm39) probably null Het
Ttc6 A G 12: 57,721,463 (GRCm39) K984R possibly damaging Het
Usp34 A G 11: 23,391,171 (GRCm39) E2263G probably damaging Het
Usp8 A G 2: 126,596,847 (GRCm39) K875E probably damaging Het
Vapb C T 2: 173,603,905 (GRCm39) probably benign Het
Vmn1r223 A G 13: 23,434,038 (GRCm39) I211V possibly damaging Het
Vmn2r81 G A 10: 79,129,496 (GRCm39) V796I probably damaging Het
Wdr90 A T 17: 26,073,027 (GRCm39) V856D probably damaging Het
Wnk2 T A 13: 49,235,571 (GRCm39) T615S probably damaging Het
Other mutations in Esrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Esrp2 APN 8 106,858,865 (GRCm39) missense probably benign 0.00
R0419:Esrp2 UTSW 8 106,861,307 (GRCm39) missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106,860,453 (GRCm39) missense probably damaging 1.00
R1528:Esrp2 UTSW 8 106,863,384 (GRCm39) missense unknown
R1598:Esrp2 UTSW 8 106,859,905 (GRCm39) missense probably damaging 0.97
R1817:Esrp2 UTSW 8 106,861,250 (GRCm39) missense probably damaging 1.00
R1885:Esrp2 UTSW 8 106,858,453 (GRCm39) missense possibly damaging 0.80
R1886:Esrp2 UTSW 8 106,860,489 (GRCm39) missense probably damaging 1.00
R2323:Esrp2 UTSW 8 106,860,934 (GRCm39) missense probably benign 0.27
R3761:Esrp2 UTSW 8 106,860,254 (GRCm39) missense probably damaging 1.00
R4598:Esrp2 UTSW 8 106,859,343 (GRCm39) missense probably damaging 1.00
R4792:Esrp2 UTSW 8 106,859,141 (GRCm39) missense probably damaging 1.00
R5091:Esrp2 UTSW 8 106,859,061 (GRCm39) missense probably damaging 1.00
R5114:Esrp2 UTSW 8 106,858,820 (GRCm39) missense probably benign 0.42
R5162:Esrp2 UTSW 8 106,859,930 (GRCm39) missense probably damaging 1.00
R5678:Esrp2 UTSW 8 106,858,750 (GRCm39) missense probably damaging 0.97
R5947:Esrp2 UTSW 8 106,859,565 (GRCm39) unclassified probably benign
R7713:Esrp2 UTSW 8 106,860,908 (GRCm39) missense probably benign 0.01
R7760:Esrp2 UTSW 8 106,860,102 (GRCm39) missense probably benign 0.03
R8348:Esrp2 UTSW 8 106,858,853 (GRCm39) missense probably damaging 1.00
R8448:Esrp2 UTSW 8 106,858,853 (GRCm39) missense probably damaging 1.00
R8494:Esrp2 UTSW 8 106,861,350 (GRCm39) missense probably damaging 0.96
R9245:Esrp2 UTSW 8 106,858,775 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGCAGGTAGAGAAACCAGCCCATAG -3'
(R):5'- AATACGAGACAGGCCCTTGGTGAG -3'

Sequencing Primer
(F):5'- CTGTCCACGAATCGGATGAG -3'
(R):5'- CCCTTGGTGAGTGTAGGAGC -3'
Posted On 2014-05-23