Incidental Mutation 'R1468:Adamts7'
List |< first << previous [record 13 of 291] next >> last >|
ID197730
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 90188798 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect probably benign
Transcript: ENSMUST00000113059
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113060
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144943
Predicted Effect probably benign
Transcript: ENSMUST00000147250
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGCCCAATGACGGTGAGTTATGC -3'
(R):5'- TGCTAACTGTGGGCTCTCCATTGC -3'

Sequencing Primer
(F):5'- AATGACGGTGAGTTATGCTACCC -3'
(R):5'- GCTCTCCATTGCCAGAGACAG -3'
Posted On2014-05-23