Incidental Mutation 'R1468:Myo15'
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1468 (G1)
Quality Score182
Status Validated
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60506006 bp
Amino Acid Change Threonine to Serine at position 2634 (T2634S)
Ref Sequence ENSEMBL: ENSMUSP00000091686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably damaging
Transcript: ENSMUST00000071880
AA Change: T2652S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: T2652S

low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: T1447S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: T1447S

MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: T2634S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: T2634S

low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122825
Predicted Effect
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: T1465S

MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
Typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 splice site probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
R7041:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R7149:Myo15 UTSW 11 60510010 missense possibly damaging 0.56
R7163:Myo15 UTSW 11 60498369 missense
R7229:Myo15 UTSW 11 60496495 missense probably benign 0.08
R7347:Myo15 UTSW 11 60477961 missense probably benign
R7368:Myo15 UTSW 11 60490915 splice site probably null
R7392:Myo15 UTSW 11 60505976 missense
R7414:Myo15 UTSW 11 60483483 missense
R7461:Myo15 UTSW 11 60505152 missense
R7609:Myo15 UTSW 11 60488811 missense
R7613:Myo15 UTSW 11 60505152 missense
R7734:Myo15 UTSW 11 60510282 missense probably benign
R7748:Myo15 UTSW 11 60504901 missense
R7767:Myo15 UTSW 11 60502096 missense
R7769:Myo15 UTSW 11 60509149 missense
R7894:Myo15 UTSW 11 60491137 missense
R7919:Myo15 UTSW 11 60526530 missense probably damaging 1.00
R8100:Myo15 UTSW 11 60517190 missense probably damaging 1.00
R8124:Myo15 UTSW 11 60507453 missense
R8129:Myo15 UTSW 11 60508200 missense
R8428:Myo15 UTSW 11 60496415 missense probably damaging 1.00
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Z1176:Myo15 UTSW 11 60488258 missense
Z1176:Myo15 UTSW 11 60498403 missense
Z1176:Myo15 UTSW 11 60524441 missense probably damaging 1.00
Z1177:Myo15 UTSW 11 60477523 missense probably damaging 1.00
Z1177:Myo15 UTSW 11 60488837 missense
Z1177:Myo15 UTSW 11 60495475 missense
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acttccacaatacctcctgtc -3'
Posted On2014-05-23