Incidental Mutation 'R1468:Dock4'
ID 197745
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R1468 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 40805809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 927 (T927K)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: T927K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: T927K

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: T927K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,246,507 (GRCm39) M1R probably null Het
4933440N22Rik C A 6: 117,884,540 (GRCm39) probably benign Het
5031439G07Rik G T 15: 84,837,345 (GRCm39) P280T probably damaging Het
Abca2 C T 2: 25,331,308 (GRCm39) S1267L probably damaging Het
Acsl3 A T 1: 78,684,126 (GRCm39) R719S probably benign Het
Adam1a A T 5: 121,657,839 (GRCm39) probably null Het
Adamts7 T C 9: 90,070,851 (GRCm39) probably benign Het
Adgrf3 G A 5: 30,407,227 (GRCm39) probably benign Het
Aldh6a1 T C 12: 84,488,544 (GRCm39) E89G possibly damaging Het
Ankrd36 A G 11: 5,525,752 (GRCm39) Y238C probably damaging Het
Ankrd65 G A 4: 155,877,362 (GRCm39) R291Q probably benign Het
Ano2 C T 6: 125,773,227 (GRCm39) R287W probably damaging Het
Ap1ar A G 3: 127,606,215 (GRCm39) I125T probably benign Het
Arid1b A G 17: 5,293,197 (GRCm39) D705G probably damaging Het
Asb18 T A 1: 89,924,005 (GRCm39) N86I probably damaging Het
Bicral A T 17: 47,135,519 (GRCm39) S564T probably benign Het
Bpifa6 A G 2: 153,831,192 (GRCm39) M253V probably benign Het
Braf T C 6: 39,642,017 (GRCm39) D194G probably damaging Het
Brinp3 C A 1: 146,777,700 (GRCm39) P716T probably benign Het
C7 T A 15: 5,041,631 (GRCm39) Y425F probably damaging Het
Ccdc102a T C 8: 95,632,714 (GRCm39) K421R probably benign Het
Cep89 G A 7: 35,120,388 (GRCm39) probably null Het
Chgb A T 2: 132,634,720 (GRCm39) M221L probably benign Het
Chst14 A G 2: 118,758,145 (GRCm39) Y313C probably damaging Het
Ciita G A 16: 10,331,152 (GRCm39) probably null Het
Clec12b A T 6: 129,357,603 (GRCm39) I85N probably damaging Het
Clec2e G T 6: 129,070,459 (GRCm39) Y187* probably null Het
Crbn T C 6: 106,767,804 (GRCm39) K229E probably benign Het
Ctdspl2 A T 2: 121,811,762 (GRCm39) Q201L probably benign Het
Ctrb1 G T 8: 112,416,041 (GRCm39) probably benign Het
Cyp2c55 T A 19: 38,999,525 (GRCm39) V77E probably damaging Het
Cyp2c69 A C 19: 39,837,839 (GRCm39) D414E probably damaging Het
Ddx47 T C 6: 134,988,703 (GRCm39) probably benign Het
Dlg1 A G 16: 31,661,640 (GRCm39) probably null Het
Dnah5 C A 15: 28,230,609 (GRCm39) S169* probably null Het
Esrp2 T G 8: 106,860,453 (GRCm39) D259A probably damaging Het
Fam169a A G 13: 97,255,038 (GRCm39) K418R probably benign Het
Fancm A T 12: 65,146,067 (GRCm39) I597F probably damaging Het
Fastkd2 G T 1: 63,771,385 (GRCm39) probably benign Het
Fat1 G A 8: 45,463,582 (GRCm39) V1375M probably damaging Het
Fbxw10 A T 11: 62,753,464 (GRCm39) D486V probably damaging Het
Fech C T 18: 64,603,744 (GRCm39) probably benign Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Foxp1 T A 6: 98,955,181 (GRCm39) H195L possibly damaging Het
Gfra1 T A 19: 58,440,407 (GRCm39) I138L probably benign Het
Gm12185 T C 11: 48,806,501 (GRCm39) D230G possibly damaging Het
Gm14403 T A 2: 177,199,024 (GRCm39) probably benign Het
Gpd2 A C 2: 57,245,786 (GRCm39) T439P probably damaging Het
Gpm6a A T 8: 55,490,385 (GRCm39) K20N probably damaging Het
Hc A T 2: 34,873,819 (GRCm39) Y158* probably null Het
Hectd4 A T 5: 121,487,235 (GRCm39) D3410V possibly damaging Het
Il17b G A 18: 61,823,483 (GRCm39) probably null Het
Irx4 G T 13: 73,413,695 (GRCm39) R55L possibly damaging Het
Itgav A T 2: 83,596,245 (GRCm39) probably benign Het
Lama3 T C 18: 12,574,164 (GRCm39) V582A probably benign Het
Ldhd G T 8: 112,353,925 (GRCm39) A425E possibly damaging Het
Lrp1b C T 2: 40,817,841 (GRCm39) probably null Het
Lrp5 T C 19: 3,670,191 (GRCm39) T638A possibly damaging Het
Lrrk1 A C 7: 65,909,722 (GRCm39) F1996C probably damaging Het
Ly6h G A 15: 75,437,986 (GRCm39) S21L probably benign Het
Mctp1 T C 13: 76,973,392 (GRCm39) V431A probably benign Het
Metap2 C T 10: 93,707,345 (GRCm39) probably null Het
Mfsd2b T A 12: 4,920,536 (GRCm39) K94* probably null Het
Micall2 A G 5: 139,705,097 (GRCm39) L79P probably damaging Het
Mucl2 T C 15: 103,927,673 (GRCm39) T95A possibly damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Myo5b G T 18: 74,873,574 (GRCm39) V1467L probably damaging Het
Nfic G T 10: 81,256,414 (GRCm39) D105E probably damaging Het
Nrdc T A 4: 108,873,865 (GRCm39) F227Y probably benign Het
Nrp2 A T 1: 62,777,458 (GRCm39) I88F probably damaging Het
Nup160 A T 2: 90,530,887 (GRCm39) H515L probably benign Het
Nup205 G A 6: 35,202,917 (GRCm39) probably null Het
Oas1g G A 5: 121,020,069 (GRCm39) T179I probably benign Het
Ogfr A T 2: 180,236,543 (GRCm39) E376V probably damaging Het
Or2l13 T G 16: 19,306,378 (GRCm39) S263R probably benign Het
Or4a69 A T 2: 89,312,855 (GRCm39) V208D possibly damaging Het
Or4c107 T G 2: 88,789,387 (GRCm39) Y192* probably null Het
Or52d1 G T 7: 103,755,896 (GRCm39) V137F possibly damaging Het
Or5p6 C T 7: 107,631,595 (GRCm39) probably null Het
Pard3b T C 1: 62,384,188 (GRCm39) V851A probably benign Het
Pcdhb16 A T 18: 37,611,142 (GRCm39) Y34F probably damaging Het
Pikfyve T C 1: 65,290,825 (GRCm39) Y1215H probably damaging Het
Pkhd1 A T 1: 20,593,565 (GRCm39) V1516E probably damaging Het
Pla2g4a A T 1: 149,763,344 (GRCm39) probably benign Het
Ptprg A T 14: 12,190,767 (GRCm38) I818F probably benign Het
Ralgapb A G 2: 158,304,173 (GRCm39) E644G possibly damaging Het
Rbm45 A G 2: 76,202,459 (GRCm39) I127M probably damaging Het
Rtp2 T C 16: 23,746,220 (GRCm39) Y157C probably damaging Het
Sema3f A T 9: 107,564,771 (GRCm39) probably benign Het
Sf3b3 A T 8: 111,564,006 (GRCm39) Y329N probably damaging Het
Sfxn1 A G 13: 54,239,646 (GRCm39) probably null Het
Shkbp1 A T 7: 27,044,751 (GRCm39) C447S probably damaging Het
Sipa1l3 A G 7: 29,021,685 (GRCm39) S689P possibly damaging Het
Slc7a8 A G 14: 54,970,656 (GRCm39) S332P probably damaging Het
Slit1 C A 19: 41,596,823 (GRCm39) C1092F probably damaging Het
Slx9 A G 10: 77,333,360 (GRCm39) probably benign Het
Stard9 A G 2: 120,533,678 (GRCm39) I619V possibly damaging Het
Sycp3 T C 10: 88,305,454 (GRCm39) V185A possibly damaging Het
Taar9 A T 10: 23,985,382 (GRCm39) N17K possibly damaging Het
Tbkbp1 T C 11: 97,039,814 (GRCm39) E102G probably damaging Het
Tex44 A G 1: 86,354,834 (GRCm39) N248D probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tnpo1 C T 13: 98,986,665 (GRCm39) V781I probably benign Het
Tonsl C T 15: 76,520,761 (GRCm39) probably null Het
Ttc6 A G 12: 57,721,463 (GRCm39) K984R possibly damaging Het
Usp34 A G 11: 23,391,171 (GRCm39) E2263G probably damaging Het
Usp8 A G 2: 126,596,847 (GRCm39) K875E probably damaging Het
Vapb C T 2: 173,603,905 (GRCm39) probably benign Het
Vmn1r223 A G 13: 23,434,038 (GRCm39) I211V possibly damaging Het
Vmn2r81 G A 10: 79,129,496 (GRCm39) V796I probably damaging Het
Wdr90 A T 17: 26,073,027 (GRCm39) V856D probably damaging Het
Wnk2 T A 13: 49,235,571 (GRCm39) T615S probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTGCTGAGTCAAAAGACCAGTGTG -3'
(R):5'- GTGCTGGAAGAATGAACCTAGTCCC -3'

Sequencing Primer
(F):5'- ACCAGTGTGCGGATGAGC -3'
(R):5'- GGAAGAATGAACCTAGTCCCATTTG -3'
Posted On 2014-05-23