Incidental Mutation 'R0083:Slc30a5'
Institutional Source Beutler Lab
Gene Symbol Slc30a5
Ensembl Gene ENSMUSG00000021629
Gene Namesolute carrier family 30 (zinc transporter), member 5
SynonymsZntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosomal Location100802648-100833427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100803400 bp
Amino Acid Change Alanine to Glutamic Acid at position 669 (A669E)
Ref Sequence ENSEMBL: ENSMUSP00000153587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]
Predicted Effect probably damaging
Transcript: ENSMUST00000067246
AA Change: A726E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: A726E

low complexity region 6 23 N/A INTRINSIC
transmembrane domain 56 75 N/A INTRINSIC
transmembrane domain 96 113 N/A INTRINSIC
transmembrane domain 128 145 N/A INTRINSIC
transmembrane domain 150 164 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
transmembrane domain 235 254 N/A INTRINSIC
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Pfam:Cation_efflux 417 645 1.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225129
Predicted Effect probably damaging
Transcript: ENSMUST00000225922
AA Change: A669E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Slc30a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Slc30a5 APN 13 100806666 missense probably damaging 1.00
IGL01647:Slc30a5 APN 13 100821145 missense possibly damaging 0.66
IGL02338:Slc30a5 APN 13 100803433 missense probably damaging 0.99
IGL02408:Slc30a5 APN 13 100813724 missense probably damaging 1.00
IGL02582:Slc30a5 APN 13 100812647 critical splice donor site probably null
IGL02987:Slc30a5 APN 13 100803915 missense probably damaging 1.00
IGL03025:Slc30a5 APN 13 100813887 missense probably damaging 0.99
IGL03064:Slc30a5 APN 13 100811310 missense probably damaging 1.00
IGL03089:Slc30a5 APN 13 100813830 missense probably benign 0.01
IGL03268:Slc30a5 APN 13 100806703 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0153:Slc30a5 UTSW 13 100826494 missense possibly damaging 0.46
R0542:Slc30a5 UTSW 13 100809285 splice site probably null
R0601:Slc30a5 UTSW 13 100814770 intron probably benign
R1125:Slc30a5 UTSW 13 100803413 missense probably damaging 1.00
R1434:Slc30a5 UTSW 13 100803442 missense probably damaging 0.98
R1673:Slc30a5 UTSW 13 100813383 missense probably benign 0.13
R1762:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R1974:Slc30a5 UTSW 13 100813953 missense probably benign 0.06
R2082:Slc30a5 UTSW 13 100806533 critical splice donor site probably null
R2151:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2152:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2153:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R3899:Slc30a5 UTSW 13 100818147 missense probably benign 0.18
R4009:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4010:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4270:Slc30a5 UTSW 13 100829013 missense probably benign 0.04
R4815:Slc30a5 UTSW 13 100813710 missense probably damaging 1.00
R5048:Slc30a5 UTSW 13 100806741 missense probably damaging 1.00
R5450:Slc30a5 UTSW 13 100821172 missense possibly damaging 0.81
R5638:Slc30a5 UTSW 13 100813872 nonsense probably null
R5892:Slc30a5 UTSW 13 100813302 missense probably damaging 1.00
R5911:Slc30a5 UTSW 13 100809092 missense probably damaging 1.00
R6453:Slc30a5 UTSW 13 100814689 missense probably benign 0.00
R6769:Slc30a5 UTSW 13 100813860 missense probably benign 0.19
R6795:Slc30a5 UTSW 13 100817069 missense probably damaging 1.00
R7020:Slc30a5 UTSW 13 100824913 splice site probably null
R7224:Slc30a5 UTSW 13 100809254 missense probably damaging 0.99
R7305:Slc30a5 UTSW 13 100811424 missense probably damaging 0.98
R7318:Slc30a5 UTSW 13 100813969 missense probably benign 0.13
R7411:Slc30a5 UTSW 13 100818180 missense probably benign 0.15
R7563:Slc30a5 UTSW 13 100803972 missense probably benign 0.30
R8039:Slc30a5 UTSW 13 100813681 critical splice donor site probably null
R8061:Slc30a5 UTSW 13 100828911 missense probably damaging 0.99
X0019:Slc30a5 UTSW 13 100813842 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcagagatacaaaagcaaatggag -3'
Posted On2013-04-11