Incidental Mutation 'R1468:Ptprg'
ID197756
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Nameprotein tyrosine phosphatase, receptor type, G
Synonyms5430405N12Rik, RPTPgamma
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1468 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location11553532-12242041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12190767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 818 (I818F)
Ref Sequence ENSEMBL: ENSMUSP00000022264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917] [ENSMUST00000226099]
Predicted Effect probably benign
Transcript: ENSMUST00000022264
AA Change: I818F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: I818F

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119888
AA Change: I43F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: I43F

DomainStartEndE-ValueType
PTPc 69 343 1.76e-136 SMART
PTPc 371 634 1.32e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223890
Predicted Effect probably benign
Transcript: ENSMUST00000226099
Meta Mutation Damage Score 0.1389 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2125:Ptprg UTSW 14 12179283 missense possibly damaging 0.74
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R3821:Ptprg UTSW 14 12226375 missense probably benign 0.00
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4825:Ptprg UTSW 14 12220654 missense probably damaging 1.00
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4972:Ptprg UTSW 14 12226427 missense possibly damaging 0.94
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7709:Ptprg UTSW 14 12226452 missense probably damaging 1.00
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCTAAACGCTGTGCTTGCATTTG -3'
(R):5'- TGCTGATGCTGCCCTACACTAACC -3'

Sequencing Primer
(F):5'- GCCATCAGCATCAGTGCTATG -3'
(R):5'- ACACTAACCCTGAGGTATTTGC -3'
Posted On2014-05-23