Incidental Mutation 'R1468:Wdr90'
ID197769
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1468 (G1)
Quality Score137
Status Validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25854053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 856 (V856D)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably damaging
Transcript: ENSMUST00000079461
AA Change: V856D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: V856D

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect probably benign
Transcript: ENSMUST00000176678
Predicted Effect probably damaging
Transcript: ENSMUST00000176923
AA Change: V838D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: V838D

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.5565 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
4933440N22Rik C A 6: 117,907,579 probably benign Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Adamts7 T C 9: 90,188,798 probably benign Het
Adgrf3 G A 5: 30,202,229 probably benign Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Crbn T C 6: 106,790,843 K229E probably benign Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Ctrb1 G T 8: 111,689,409 probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Ddx47 T C 6: 135,011,740 probably benign Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fam207a A G 10: 77,497,526 probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fastkd2 G T 1: 63,732,226 probably benign Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fech C T 18: 64,470,673 probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gm14403 T A 2: 177,507,231 probably benign Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Itgav A T 2: 83,765,901 probably benign Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Pla2g4a A T 1: 149,887,593 probably benign Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sema3f A T 9: 107,687,572 probably benign Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vapb C T 2: 173,762,112 probably benign Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGATGTGGTTTATGGTGGCAC -3'
(R):5'- TTTCTACAGAACCGAACCGGGGAC -3'

Sequencing Primer
(F):5'- ACTGGCTTTCCTGCAAAGG -3'
(R):5'- aaatctgactgcctctgcc -3'
Posted On2014-05-23