Incidental Mutation 'R1468:Myo5b'
ID 197776
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 039521-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R1468 (G1)
Quality Score 223
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74873574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1467 (V1467L)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: V1467L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: V1467L

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: V1493L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: V1493L

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Meta Mutation Damage Score 0.1271 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,246,507 (GRCm39) M1R probably null Het
4933440N22Rik C A 6: 117,884,540 (GRCm39) probably benign Het
5031439G07Rik G T 15: 84,837,345 (GRCm39) P280T probably damaging Het
Abca2 C T 2: 25,331,308 (GRCm39) S1267L probably damaging Het
Acsl3 A T 1: 78,684,126 (GRCm39) R719S probably benign Het
Adam1a A T 5: 121,657,839 (GRCm39) probably null Het
Adamts7 T C 9: 90,070,851 (GRCm39) probably benign Het
Adgrf3 G A 5: 30,407,227 (GRCm39) probably benign Het
Aldh6a1 T C 12: 84,488,544 (GRCm39) E89G possibly damaging Het
Ankrd36 A G 11: 5,525,752 (GRCm39) Y238C probably damaging Het
Ankrd65 G A 4: 155,877,362 (GRCm39) R291Q probably benign Het
Ano2 C T 6: 125,773,227 (GRCm39) R287W probably damaging Het
Ap1ar A G 3: 127,606,215 (GRCm39) I125T probably benign Het
Arid1b A G 17: 5,293,197 (GRCm39) D705G probably damaging Het
Asb18 T A 1: 89,924,005 (GRCm39) N86I probably damaging Het
Bicral A T 17: 47,135,519 (GRCm39) S564T probably benign Het
Bpifa6 A G 2: 153,831,192 (GRCm39) M253V probably benign Het
Braf T C 6: 39,642,017 (GRCm39) D194G probably damaging Het
Brinp3 C A 1: 146,777,700 (GRCm39) P716T probably benign Het
C7 T A 15: 5,041,631 (GRCm39) Y425F probably damaging Het
Ccdc102a T C 8: 95,632,714 (GRCm39) K421R probably benign Het
Cep89 G A 7: 35,120,388 (GRCm39) probably null Het
Chgb A T 2: 132,634,720 (GRCm39) M221L probably benign Het
Chst14 A G 2: 118,758,145 (GRCm39) Y313C probably damaging Het
Ciita G A 16: 10,331,152 (GRCm39) probably null Het
Clec12b A T 6: 129,357,603 (GRCm39) I85N probably damaging Het
Clec2e G T 6: 129,070,459 (GRCm39) Y187* probably null Het
Crbn T C 6: 106,767,804 (GRCm39) K229E probably benign Het
Ctdspl2 A T 2: 121,811,762 (GRCm39) Q201L probably benign Het
Ctrb1 G T 8: 112,416,041 (GRCm39) probably benign Het
Cyp2c55 T A 19: 38,999,525 (GRCm39) V77E probably damaging Het
Cyp2c69 A C 19: 39,837,839 (GRCm39) D414E probably damaging Het
Ddx47 T C 6: 134,988,703 (GRCm39) probably benign Het
Dlg1 A G 16: 31,661,640 (GRCm39) probably null Het
Dnah5 C A 15: 28,230,609 (GRCm39) S169* probably null Het
Dock4 C A 12: 40,805,809 (GRCm39) T927K probably benign Het
Esrp2 T G 8: 106,860,453 (GRCm39) D259A probably damaging Het
Fam169a A G 13: 97,255,038 (GRCm39) K418R probably benign Het
Fancm A T 12: 65,146,067 (GRCm39) I597F probably damaging Het
Fastkd2 G T 1: 63,771,385 (GRCm39) probably benign Het
Fat1 G A 8: 45,463,582 (GRCm39) V1375M probably damaging Het
Fbxw10 A T 11: 62,753,464 (GRCm39) D486V probably damaging Het
Fech C T 18: 64,603,744 (GRCm39) probably benign Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Foxp1 T A 6: 98,955,181 (GRCm39) H195L possibly damaging Het
Gfra1 T A 19: 58,440,407 (GRCm39) I138L probably benign Het
Gm12185 T C 11: 48,806,501 (GRCm39) D230G possibly damaging Het
Gm14403 T A 2: 177,199,024 (GRCm39) probably benign Het
Gpd2 A C 2: 57,245,786 (GRCm39) T439P probably damaging Het
Gpm6a A T 8: 55,490,385 (GRCm39) K20N probably damaging Het
Hc A T 2: 34,873,819 (GRCm39) Y158* probably null Het
Hectd4 A T 5: 121,487,235 (GRCm39) D3410V possibly damaging Het
Il17b G A 18: 61,823,483 (GRCm39) probably null Het
Irx4 G T 13: 73,413,695 (GRCm39) R55L possibly damaging Het
Itgav A T 2: 83,596,245 (GRCm39) probably benign Het
Lama3 T C 18: 12,574,164 (GRCm39) V582A probably benign Het
Ldhd G T 8: 112,353,925 (GRCm39) A425E possibly damaging Het
Lrp1b C T 2: 40,817,841 (GRCm39) probably null Het
Lrp5 T C 19: 3,670,191 (GRCm39) T638A possibly damaging Het
Lrrk1 A C 7: 65,909,722 (GRCm39) F1996C probably damaging Het
Ly6h G A 15: 75,437,986 (GRCm39) S21L probably benign Het
Mctp1 T C 13: 76,973,392 (GRCm39) V431A probably benign Het
Metap2 C T 10: 93,707,345 (GRCm39) probably null Het
Mfsd2b T A 12: 4,920,536 (GRCm39) K94* probably null Het
Micall2 A G 5: 139,705,097 (GRCm39) L79P probably damaging Het
Mucl2 T C 15: 103,927,673 (GRCm39) T95A possibly damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nfic G T 10: 81,256,414 (GRCm39) D105E probably damaging Het
Nrdc T A 4: 108,873,865 (GRCm39) F227Y probably benign Het
Nrp2 A T 1: 62,777,458 (GRCm39) I88F probably damaging Het
Nup160 A T 2: 90,530,887 (GRCm39) H515L probably benign Het
Nup205 G A 6: 35,202,917 (GRCm39) probably null Het
Oas1g G A 5: 121,020,069 (GRCm39) T179I probably benign Het
Ogfr A T 2: 180,236,543 (GRCm39) E376V probably damaging Het
Or2l13 T G 16: 19,306,378 (GRCm39) S263R probably benign Het
Or4a69 A T 2: 89,312,855 (GRCm39) V208D possibly damaging Het
Or4c107 T G 2: 88,789,387 (GRCm39) Y192* probably null Het
Or52d1 G T 7: 103,755,896 (GRCm39) V137F possibly damaging Het
Or5p6 C T 7: 107,631,595 (GRCm39) probably null Het
Pard3b T C 1: 62,384,188 (GRCm39) V851A probably benign Het
Pcdhb16 A T 18: 37,611,142 (GRCm39) Y34F probably damaging Het
Pikfyve T C 1: 65,290,825 (GRCm39) Y1215H probably damaging Het
Pkhd1 A T 1: 20,593,565 (GRCm39) V1516E probably damaging Het
Pla2g4a A T 1: 149,763,344 (GRCm39) probably benign Het
Ptprg A T 14: 12,190,767 (GRCm38) I818F probably benign Het
Ralgapb A G 2: 158,304,173 (GRCm39) E644G possibly damaging Het
Rbm45 A G 2: 76,202,459 (GRCm39) I127M probably damaging Het
Rtp2 T C 16: 23,746,220 (GRCm39) Y157C probably damaging Het
Sema3f A T 9: 107,564,771 (GRCm39) probably benign Het
Sf3b3 A T 8: 111,564,006 (GRCm39) Y329N probably damaging Het
Sfxn1 A G 13: 54,239,646 (GRCm39) probably null Het
Shkbp1 A T 7: 27,044,751 (GRCm39) C447S probably damaging Het
Sipa1l3 A G 7: 29,021,685 (GRCm39) S689P possibly damaging Het
Slc7a8 A G 14: 54,970,656 (GRCm39) S332P probably damaging Het
Slit1 C A 19: 41,596,823 (GRCm39) C1092F probably damaging Het
Slx9 A G 10: 77,333,360 (GRCm39) probably benign Het
Stard9 A G 2: 120,533,678 (GRCm39) I619V possibly damaging Het
Sycp3 T C 10: 88,305,454 (GRCm39) V185A possibly damaging Het
Taar9 A T 10: 23,985,382 (GRCm39) N17K possibly damaging Het
Tbkbp1 T C 11: 97,039,814 (GRCm39) E102G probably damaging Het
Tex44 A G 1: 86,354,834 (GRCm39) N248D probably benign Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tnpo1 C T 13: 98,986,665 (GRCm39) V781I probably benign Het
Tonsl C T 15: 76,520,761 (GRCm39) probably null Het
Ttc6 A G 12: 57,721,463 (GRCm39) K984R possibly damaging Het
Usp34 A G 11: 23,391,171 (GRCm39) E2263G probably damaging Het
Usp8 A G 2: 126,596,847 (GRCm39) K875E probably damaging Het
Vapb C T 2: 173,603,905 (GRCm39) probably benign Het
Vmn1r223 A G 13: 23,434,038 (GRCm39) I211V possibly damaging Het
Vmn2r81 G A 10: 79,129,496 (GRCm39) V796I probably damaging Het
Wdr90 A T 17: 26,073,027 (GRCm39) V856D probably damaging Het
Wnk2 T A 13: 49,235,571 (GRCm39) T615S probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCTTGTTCAAGCCCTGTGAGGAG -3'
(R):5'- ATCTTAGCGGGCAGACAGGCTTTC -3'

Sequencing Primer
(F):5'- GAGTAGATTCCTAGATGAGCCAC -3'
(R):5'- GGCATCCCAGATAACTGGCAG -3'
Posted On 2014-05-23