Incidental Mutation 'R1469:Erbb4'
ID 197786
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 039522-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1469 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 68599841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 79 (S79A)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: S79A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: S79A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: S79A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: S79A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
AA Change: S79A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: S79A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.4892 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.6%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,039,526 (GRCm39) V261E probably damaging Het
Abca15 A G 7: 119,981,720 (GRCm39) E1058G probably benign Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Actn4 G A 7: 28,597,691 (GRCm39) probably benign Het
Actn4 A G 7: 28,604,753 (GRCm39) V348A probably benign Het
Agtr1b A T 3: 20,369,664 (GRCm39) L314H probably damaging Het
Ankrd55 T C 13: 112,504,460 (GRCm39) M402T probably benign Het
Antxrl T C 14: 33,789,388 (GRCm39) probably benign Het
Asap2 A G 12: 21,263,180 (GRCm39) Q265R probably benign Het
Atp2b4 G A 1: 133,634,677 (GRCm39) R1124C probably damaging Het
Atp2c1 A T 9: 105,312,351 (GRCm39) C353* probably null Het
Atp8b5 T A 4: 43,291,733 (GRCm39) probably null Het
Baz1b T A 5: 135,246,833 (GRCm39) Y761N probably damaging Het
Bend6 A G 1: 33,903,824 (GRCm39) V38A probably benign Het
Camk1g T C 1: 193,044,399 (GRCm39) E5G possibly damaging Het
Ccdc14 T A 16: 34,527,152 (GRCm39) H352Q probably damaging Het
Cdh2 A G 18: 16,757,324 (GRCm39) V641A possibly damaging Het
Celsr2 C A 3: 108,321,424 (GRCm39) D463Y probably damaging Het
Cldn16 C A 16: 26,292,930 (GRCm39) probably benign Het
Clec7a A C 6: 129,449,535 (GRCm39) probably benign Het
Cnih2 T C 19: 5,143,730 (GRCm39) Y142C probably damaging Het
Coa5 T A 1: 37,459,681 (GRCm39) R71* probably null Het
Csmd3 A T 15: 47,532,598 (GRCm39) Y2532* probably null Het
Cytl1 A T 5: 37,892,991 (GRCm39) M34L probably benign Het
Dctn1 T A 6: 83,169,871 (GRCm39) I590N probably damaging Het
Dhx57 T C 17: 80,561,847 (GRCm39) H889R probably damaging Het
Dock10 A G 1: 80,490,275 (GRCm39) I1948T probably benign Het
Dock3 A T 9: 106,832,908 (GRCm39) N1034K probably benign Het
Dzip1l G A 9: 99,541,829 (GRCm39) probably null Het
Eif4g1 T A 16: 20,498,758 (GRCm39) V439E possibly damaging Het
Eml5 T C 12: 98,825,082 (GRCm39) I712V probably benign Het
Entrep1 G A 19: 23,950,970 (GRCm39) T537I probably benign Het
Epha3 C T 16: 63,473,857 (GRCm39) G300D probably damaging Het
Gclc T C 9: 77,688,419 (GRCm39) V205A probably benign Het
Gdpd4 A G 7: 97,623,673 (GRCm39) probably null Het
Gm11564 C T 11: 99,706,058 (GRCm39) C124Y unknown Het
Gm16494 T C 17: 47,327,770 (GRCm39) E38G probably damaging Het
Gtf2h1 T C 7: 46,454,549 (GRCm39) probably null Het
Gtsf2 G T 15: 103,349,644 (GRCm39) R68S probably benign Het
Heatr5b T C 17: 79,115,813 (GRCm39) Q881R probably damaging Het
Hmox1 C A 8: 75,825,463 (GRCm39) L236I probably benign Het
Ighv8-12 T C 12: 115,611,963 (GRCm39) I7V probably benign Het
Itprip A G 19: 47,885,314 (GRCm39) Y434H probably damaging Het
Izumo1 T C 7: 45,272,437 (GRCm39) S73P probably damaging Het
Kifbp A T 10: 62,395,229 (GRCm39) F471Y probably damaging Het
Knl1 A G 2: 118,901,827 (GRCm39) N1176S possibly damaging Het
Limch1 T C 5: 67,039,323 (GRCm39) probably benign Het
Mecom A T 3: 30,034,197 (GRCm39) L493Q probably damaging Het
Mprip T C 11: 59,650,016 (GRCm39) V1240A probably damaging Het
Mrpl3 T C 9: 104,954,201 (GRCm39) S302P probably damaging Het
Muc19 T C 15: 91,758,498 (GRCm39) noncoding transcript Het
Mycbp2 T C 14: 103,425,956 (GRCm39) T2390A probably damaging Het
Myo1c T C 11: 75,560,787 (GRCm39) S766P probably damaging Het
Myo9b A G 8: 71,743,680 (GRCm39) Q247R probably damaging Het
Nav3 G A 10: 109,596,369 (GRCm39) T1423I probably damaging Het
Nefh A T 11: 4,890,066 (GRCm39) I851N probably benign Het
Nup98 T C 7: 101,788,008 (GRCm39) T1004A probably benign Het
Or1e17 T C 11: 73,831,383 (GRCm39) F104L probably benign Het
Or1e22 G A 11: 73,377,149 (GRCm39) S167L possibly damaging Het
Or5k8 G A 16: 58,644,973 (GRCm39) T33I probably benign Het
Or5p76 T C 7: 108,122,411 (GRCm39) T249A probably benign Het
Osgin1 G T 8: 120,172,124 (GRCm39) R306L possibly damaging Het
Otof A G 5: 30,537,571 (GRCm39) L1246P probably benign Het
Pde8a T A 7: 80,952,019 (GRCm39) N273K probably damaging Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Pkd1l3 T C 8: 110,373,585 (GRCm39) S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,400,282 (GRCm39) V2142A probably benign Het
Plb1 A G 5: 32,512,170 (GRCm39) E1318G possibly damaging Het
Plekhh2 A G 17: 84,883,199 (GRCm39) I756V probably benign Het
Prag1 A T 8: 36,613,452 (GRCm39) probably benign Het
Primpol A G 8: 47,046,672 (GRCm39) V208A probably benign Het
Ptch2 C A 4: 116,965,662 (GRCm39) A389E probably benign Het
Pzp A G 6: 128,489,319 (GRCm39) Y431H probably benign Het
Rnf43 G A 11: 87,622,233 (GRCm39) G445R probably damaging Het
Scn5a A T 9: 119,362,727 (GRCm39) probably null Het
Sf3a1 A T 11: 4,125,380 (GRCm39) probably benign Het
Shisa9 T A 16: 11,802,935 (GRCm39) M164K probably damaging Het
Skint1 A G 4: 111,882,708 (GRCm39) I251V probably benign Het
Slc16a14 C T 1: 84,907,182 (GRCm39) D31N probably damaging Het
Slc22a13 T C 9: 119,022,361 (GRCm39) S548G possibly damaging Het
Slc4a9 T C 18: 36,664,154 (GRCm39) F316L probably benign Het
Smchd1 C T 17: 71,656,725 (GRCm39) R1914H probably damaging Het
Snx16 C T 3: 10,499,431 (GRCm39) D200N probably damaging Het
Spock3 A G 8: 63,404,934 (GRCm39) D34G probably damaging Het
Sspo T C 6: 48,467,916 (GRCm39) C4154R probably damaging Het
Sytl3 C T 17: 6,954,723 (GRCm39) A131V probably benign Het
Tacc1 T A 8: 25,672,271 (GRCm39) D319V probably benign Het
Tead1 A T 7: 112,475,391 (GRCm39) K234I probably damaging Het
Tgfbrap1 C T 1: 43,114,618 (GRCm39) V161I probably benign Het
Tmem94 T C 11: 115,685,917 (GRCm39) probably benign Het
Tnfaip3 A G 10: 18,884,017 (GRCm39) V121A probably damaging Het
Tnnt2 A G 1: 135,779,793 (GRCm39) T297A possibly damaging Het
Trappc11 G A 8: 47,957,000 (GRCm39) L809F probably damaging Het
Ttn T C 2: 76,601,869 (GRCm39) I18598V probably benign Het
Ube2o A G 11: 116,436,650 (GRCm39) probably benign Het
Unc5a A G 13: 55,144,232 (GRCm39) N186D probably damaging Het
Uqcrfs1 C A 13: 30,724,784 (GRCm39) G252V probably damaging Het
Vmn2r115 T C 17: 23,564,992 (GRCm39) I293T probably damaging Het
Vmn2r9 T C 5: 108,991,694 (GRCm39) T556A probably benign Het
Wnk1 G A 6: 119,927,645 (GRCm39) probably benign Het
Ythdc2 T A 18: 44,997,529 (GRCm39) Y1029N probably benign Het
Zfp451 T A 1: 33,808,894 (GRCm39) K989M possibly damaging Het
Zfpm1 C T 8: 123,062,585 (GRCm39) T548M probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAGTCCAAAGTTGCCATCTTTCCTG -3'
(R):5'- ACTGTGTCCCAGAGTCTATAGCCAATG -3'

Sequencing Primer
(F):5'- CTGTAGTTTAAGAATATCGCTAAGGC -3'
(R):5'- CTCATCTCAGGTGTGAGAAATGTC -3'
Posted On 2014-05-23