Mutagenetix > Incidental Mutation

Incidental Mutation 'R1469:Otof'

197802

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

039522-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R1469 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30380227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1246 (L1246P)

Ref Sequence

ENSEMBL: ENSMUSP00000073803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074171
AA Change: L1246P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: L1246P

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114747

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Meta Mutation Damage Score

0.1626

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.8%
20x: 90.6%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,891,679	V261E	probably damaging	Het
Abca15	A	G	7: 120,382,497	E1058G	probably benign	Het
Abcb5	T	G	12: 118,867,946	I1224L	possibly damaging	Het
Actn4	G	A	7: 28,898,266		probably benign	Het
Actn4	A	G	7: 28,905,328	V348A	probably benign	Het
Agtr1b	A	T	3: 20,315,500	L314H	probably damaging	Het
Ankrd55	T	C	13: 112,367,926	M402T	probably benign	Het
Antxrl	T	C	14: 34,067,431		probably benign	Het
Asap2	A	G	12: 21,213,179	Q265R	probably benign	Het
Atp2b4	G	A	1: 133,706,939	R1124C	probably damaging	Het
Atp2c1	A	T	9: 105,435,152	C353*	probably null	Het
Atp8b5	T	A	4: 43,291,733		probably null	Het
Baz1b	T	A	5: 135,217,979	Y761N	probably damaging	Het
Bend6	A	G	1: 33,864,743	V38A	probably benign	Het
Camk1g	T	C	1: 193,362,091	E5G	possibly damaging	Het
Ccdc14	T	A	16: 34,706,782	H352Q	probably damaging	Het
Cdh2	A	G	18: 16,624,267	V641A	possibly damaging	Het
Celsr2	C	A	3: 108,414,108	D463Y	probably damaging	Het
Cldn16	C	A	16: 26,474,180		probably benign	Het
Clec7a	A	C	6: 129,472,572		probably benign	Het
Cnih2	T	C	19: 5,093,702	Y142C	probably damaging	Het
Coa5	T	A	1: 37,420,600	R71*	probably null	Het
Csmd3	A	T	15: 47,669,202	Y2532*	probably null	Het
Cytl1	A	T	5: 37,735,647	M34L	probably benign	Het
Dctn1	T	A	6: 83,192,889	I590N	probably damaging	Het
Dhx57	T	C	17: 80,254,418	H889R	probably damaging	Het
Dock10	A	G	1: 80,512,558	I1948T	probably benign	Het
Dock3	A	T	9: 106,955,709	N1034K	probably benign	Het
Dzip1l	G	A	9: 99,659,776		probably null	Het
Eif4g1	T	A	16: 20,680,008	V439E	possibly damaging	Het
Eml5	T	C	12: 98,858,823	I712V	probably benign	Het
Epha3	C	T	16: 63,653,494	G300D	probably damaging	Het
Erbb4	A	C	1: 68,560,682	S79A	probably damaging	Het
Fam189a2	G	A	19: 23,973,606	T537I	probably benign	Het
Gclc	T	C	9: 77,781,137	V205A	probably benign	Het
Gdpd4	A	G	7: 97,974,466		probably null	Het
Gm11564	C	T	11: 99,815,232	C124Y	unknown	Het
Gm16494	T	C	17: 47,016,844	E38G	probably damaging	Het
Gtf2h1	T	C	7: 46,805,125		probably null	Het
Gtsf2	G	T	15: 103,441,217	R68S	probably benign	Het
Heatr5b	T	C	17: 78,808,384	Q881R	probably damaging	Het
Hmox1	C	A	8: 75,098,835	L236I	probably benign	Het
Ighv8-12	T	C	12: 115,648,343	I7V	probably benign	Het
Itprip	A	G	19: 47,896,875	Y434H	probably damaging	Het
Izumo1	T	C	7: 45,623,013	S73P	probably damaging	Het
Kif1bp	A	T	10: 62,559,450	F471Y	probably damaging	Het
Knl1	A	G	2: 119,071,346	N1176S	possibly damaging	Het
Limch1	T	C	5: 66,881,980		probably benign	Het
Mecom	A	T	3: 29,980,048	L493Q	probably damaging	Het
Mprip	T	C	11: 59,759,190	V1240A	probably damaging	Het
Mrpl3	T	C	9: 105,077,002	S302P	probably damaging	Het
Muc19	T	C	15: 91,874,300		noncoding transcript	Het
Mycbp2	T	C	14: 103,188,520	T2390A	probably damaging	Het
Myo1c	T	C	11: 75,669,961	S766P	probably damaging	Het
Myo9b	A	G	8: 71,291,036	Q247R	probably damaging	Het
Nav3	G	A	10: 109,760,508	T1423I	probably damaging	Het
Nefh	A	T	11: 4,940,066	I851N	probably benign	Het
Nup98	T	C	7: 102,138,801	T1004A	probably benign	Het
Olfr175-ps1	G	A	16: 58,824,610	T33I	probably benign	Het
Olfr23	T	C	11: 73,940,557	F104L	probably benign	Het
Olfr381	G	A	11: 73,486,323	S167L	possibly damaging	Het
Olfr502	T	C	7: 108,523,204	T249A	probably benign	Het
Osgin1	G	T	8: 119,445,385	R306L	possibly damaging	Het
Pde8a	T	A	7: 81,302,271	N273K	probably damaging	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Pkd1l3	T	C	8: 109,646,953	S1374P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,536,886	V2142A	probably benign	Het
Plb1	A	G	5: 32,354,826	E1318G	possibly damaging	Het
Plekhh2	A	G	17: 84,575,771	I756V	probably benign	Het
Prag1	A	T	8: 36,146,298		probably benign	Het
Primpol	A	G	8: 46,593,637	V208A	probably benign	Het
Ptch2	C	A	4: 117,108,465	A389E	probably benign	Het
Pzp	A	G	6: 128,512,356	Y431H	probably benign	Het
Rnf43	G	A	11: 87,731,407	G445R	probably damaging	Het
Scn5a	A	T	9: 119,533,661		probably null	Het
Sf3a1	A	T	11: 4,175,380		probably benign	Het
Shisa9	T	A	16: 11,985,071	M164K	probably damaging	Het
Skint1	A	G	4: 112,025,511	I251V	probably benign	Het
Slc16a14	C	T	1: 84,929,461	D31N	probably damaging	Het
Slc22a13	T	C	9: 119,193,295	S548G	possibly damaging	Het
Slc4a9	T	C	18: 36,531,101	F316L	probably benign	Het
Smchd1	C	T	17: 71,349,730	R1914H	probably damaging	Het
Snx16	C	T	3: 10,434,371	D200N	probably damaging	Het
Spock3	A	G	8: 62,951,900	D34G	probably damaging	Het
Sspo	T	C	6: 48,490,982	C4154R	probably damaging	Het
Sytl3	C	T	17: 6,687,324	A131V	probably benign	Het
Tacc1	T	A	8: 25,182,255	D319V	probably benign	Het
Tead1	A	T	7: 112,876,184	K234I	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,458	V161I	probably benign	Het
Tmem94	T	C	11: 115,795,091		probably benign	Het
Tnfaip3	A	G	10: 19,008,269	V121A	probably damaging	Het
Tnnt2	A	G	1: 135,852,055	T297A	possibly damaging	Het
Trappc11	G	A	8: 47,503,965	L809F	probably damaging	Het
Ttn	T	C	2: 76,771,525	I18598V	probably benign	Het
Ube2o	A	G	11: 116,545,824		probably benign	Het
Unc5a	A	G	13: 54,996,419	N186D	probably damaging	Het
Uqcrfs1	C	A	13: 30,540,801	G252V	probably damaging	Het
Vmn2r115	T	C	17: 23,346,018	I293T	probably damaging	Het
Vmn2r9	T	C	5: 108,843,828	T556A	probably benign	Het
Wnk1	G	A	6: 119,950,684		probably benign	Het
Ythdc2	T	A	18: 44,864,462	Y1029N	probably benign	Het
Zfp451	T	A	1: 33,769,813	K989M	possibly damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTAACCATTACAGTTCCACGGC -3'
(R):5'- TGGATGCACAATGACCCACCCTTC -3'

Sequencing Primer
(F):5'- TCCAGACAGTGCTATGTGATCAAG -3'
(R):5'- GACCCACCCTTCCCTCTAAC -3'

Posted On

2014-05-23