Mutagenetix > Incidental Mutation

Incidental Mutation 'R1469:Trappc11'

197828

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

039522-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1469 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47503965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 809 (L809F)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

AlphaFold

B2RXC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039061
AA Change: L809F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: L809F

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.1365

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.8%
20x: 90.6%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,891,679	V261E	probably damaging	Het
Abca15	A	G	7: 120,382,497	E1058G	probably benign	Het
Abcb5	T	G	12: 118,867,946	I1224L	possibly damaging	Het
Actn4	G	A	7: 28,898,266		probably benign	Het
Actn4	A	G	7: 28,905,328	V348A	probably benign	Het
Agtr1b	A	T	3: 20,315,500	L314H	probably damaging	Het
Ankrd55	T	C	13: 112,367,926	M402T	probably benign	Het
Antxrl	T	C	14: 34,067,431		probably benign	Het
Asap2	A	G	12: 21,213,179	Q265R	probably benign	Het
Atp2b4	G	A	1: 133,706,939	R1124C	probably damaging	Het
Atp2c1	A	T	9: 105,435,152	C353*	probably null	Het
Atp8b5	T	A	4: 43,291,733		probably null	Het
Baz1b	T	A	5: 135,217,979	Y761N	probably damaging	Het
Bend6	A	G	1: 33,864,743	V38A	probably benign	Het
Camk1g	T	C	1: 193,362,091	E5G	possibly damaging	Het
Ccdc14	T	A	16: 34,706,782	H352Q	probably damaging	Het
Cdh2	A	G	18: 16,624,267	V641A	possibly damaging	Het
Celsr2	C	A	3: 108,414,108	D463Y	probably damaging	Het
Cldn16	C	A	16: 26,474,180		probably benign	Het
Clec7a	A	C	6: 129,472,572		probably benign	Het
Cnih2	T	C	19: 5,093,702	Y142C	probably damaging	Het
Coa5	T	A	1: 37,420,600	R71*	probably null	Het
Csmd3	A	T	15: 47,669,202	Y2532*	probably null	Het
Cytl1	A	T	5: 37,735,647	M34L	probably benign	Het
Dctn1	T	A	6: 83,192,889	I590N	probably damaging	Het
Dhx57	T	C	17: 80,254,418	H889R	probably damaging	Het
Dock10	A	G	1: 80,512,558	I1948T	probably benign	Het
Dock3	A	T	9: 106,955,709	N1034K	probably benign	Het
Dzip1l	G	A	9: 99,659,776		probably null	Het
Eif4g1	T	A	16: 20,680,008	V439E	possibly damaging	Het
Eml5	T	C	12: 98,858,823	I712V	probably benign	Het
Epha3	C	T	16: 63,653,494	G300D	probably damaging	Het
Erbb4	A	C	1: 68,560,682	S79A	probably damaging	Het
Fam189a2	G	A	19: 23,973,606	T537I	probably benign	Het
Gclc	T	C	9: 77,781,137	V205A	probably benign	Het
Gdpd4	A	G	7: 97,974,466		probably null	Het
Gm11564	C	T	11: 99,815,232	C124Y	unknown	Het
Gm16494	T	C	17: 47,016,844	E38G	probably damaging	Het
Gtf2h1	T	C	7: 46,805,125		probably null	Het
Gtsf2	G	T	15: 103,441,217	R68S	probably benign	Het
Heatr5b	T	C	17: 78,808,384	Q881R	probably damaging	Het
Hmox1	C	A	8: 75,098,835	L236I	probably benign	Het
Ighv8-12	T	C	12: 115,648,343	I7V	probably benign	Het
Itprip	A	G	19: 47,896,875	Y434H	probably damaging	Het
Izumo1	T	C	7: 45,623,013	S73P	probably damaging	Het
Kif1bp	A	T	10: 62,559,450	F471Y	probably damaging	Het
Knl1	A	G	2: 119,071,346	N1176S	possibly damaging	Het
Limch1	T	C	5: 66,881,980		probably benign	Het
Mecom	A	T	3: 29,980,048	L493Q	probably damaging	Het
Mprip	T	C	11: 59,759,190	V1240A	probably damaging	Het
Mrpl3	T	C	9: 105,077,002	S302P	probably damaging	Het
Muc19	T	C	15: 91,874,300		noncoding transcript	Het
Mycbp2	T	C	14: 103,188,520	T2390A	probably damaging	Het
Myo1c	T	C	11: 75,669,961	S766P	probably damaging	Het
Myo9b	A	G	8: 71,291,036	Q247R	probably damaging	Het
Nav3	G	A	10: 109,760,508	T1423I	probably damaging	Het
Nefh	A	T	11: 4,940,066	I851N	probably benign	Het
Nup98	T	C	7: 102,138,801	T1004A	probably benign	Het
Olfr175-ps1	G	A	16: 58,824,610	T33I	probably benign	Het
Olfr23	T	C	11: 73,940,557	F104L	probably benign	Het
Olfr381	G	A	11: 73,486,323	S167L	possibly damaging	Het
Olfr502	T	C	7: 108,523,204	T249A	probably benign	Het
Osgin1	G	T	8: 119,445,385	R306L	possibly damaging	Het
Otof	A	G	5: 30,380,227	L1246P	probably benign	Het
Pde8a	T	A	7: 81,302,271	N273K	probably damaging	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Pkd1l3	T	C	8: 109,646,953	S1374P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,536,886	V2142A	probably benign	Het
Plb1	A	G	5: 32,354,826	E1318G	possibly damaging	Het
Plekhh2	A	G	17: 84,575,771	I756V	probably benign	Het
Prag1	A	T	8: 36,146,298		probably benign	Het
Primpol	A	G	8: 46,593,637	V208A	probably benign	Het
Ptch2	C	A	4: 117,108,465	A389E	probably benign	Het
Pzp	A	G	6: 128,512,356	Y431H	probably benign	Het
Rnf43	G	A	11: 87,731,407	G445R	probably damaging	Het
Scn5a	A	T	9: 119,533,661		probably null	Het
Sf3a1	A	T	11: 4,175,380		probably benign	Het
Shisa9	T	A	16: 11,985,071	M164K	probably damaging	Het
Skint1	A	G	4: 112,025,511	I251V	probably benign	Het
Slc16a14	C	T	1: 84,929,461	D31N	probably damaging	Het
Slc22a13	T	C	9: 119,193,295	S548G	possibly damaging	Het
Slc4a9	T	C	18: 36,531,101	F316L	probably benign	Het
Smchd1	C	T	17: 71,349,730	R1914H	probably damaging	Het
Snx16	C	T	3: 10,434,371	D200N	probably damaging	Het
Spock3	A	G	8: 62,951,900	D34G	probably damaging	Het
Sspo	T	C	6: 48,490,982	C4154R	probably damaging	Het
Sytl3	C	T	17: 6,687,324	A131V	probably benign	Het
Tacc1	T	A	8: 25,182,255	D319V	probably benign	Het
Tead1	A	T	7: 112,876,184	K234I	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,458	V161I	probably benign	Het
Tmem94	T	C	11: 115,795,091		probably benign	Het
Tnfaip3	A	G	10: 19,008,269	V121A	probably damaging	Het
Tnnt2	A	G	1: 135,852,055	T297A	possibly damaging	Het
Ttn	T	C	2: 76,771,525	I18598V	probably benign	Het
Ube2o	A	G	11: 116,545,824		probably benign	Het
Unc5a	A	G	13: 54,996,419	N186D	probably damaging	Het
Uqcrfs1	C	A	13: 30,540,801	G252V	probably damaging	Het
Vmn2r115	T	C	17: 23,346,018	I293T	probably damaging	Het
Vmn2r9	T	C	5: 108,843,828	T556A	probably benign	Het
Wnk1	G	A	6: 119,950,684		probably benign	Het
Ythdc2	T	A	18: 44,864,462	Y1029N	probably benign	Het
Zfp451	T	A	1: 33,769,813	K989M	possibly damaging	Het
Zfpm1	C	T	8: 122,335,846	T548M	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATCTCACCAGCGGCAGCAGG -3'
(R):5'- GGAACAAGGTAAACACCATGACATCAGT -3'

Sequencing Primer
(F):5'- TGTAAAATTCCAGGAACTGCTG -3'
(R):5'- ACACCATGACATCAGTGATAGG -3'

Posted On

2014-05-23