Incidental Mutation 'R1469:Kif1bp'
ID197843
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1469 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62559450 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 471 (F471Y)
Ref Sequence ENSEMBL: ENSMUSP00000065160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect probably damaging
Transcript: ENSMUST00000065887
AA Change: F471Y

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: F471Y

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159704
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162263
Predicted Effect probably benign
Transcript: ENSMUST00000162525
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
Predicted Effect probably benign
Transcript: ENSMUST00000162759
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208223
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.6%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 G A 7: 28,898,266 probably benign Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Antxrl T C 14: 34,067,431 probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cldn16 C A 16: 26,474,180 probably benign Het
Clec7a A C 6: 129,472,572 probably benign Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Itprip A G 19: 47,896,875 Y434H probably damaging Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Limch1 T C 5: 66,881,980 probably benign Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Muc19 T C 15: 91,874,300 noncoding transcript Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Prag1 A T 8: 36,146,298 probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sf3a1 A T 11: 4,175,380 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tmem94 T C 11: 115,795,091 probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ube2o A G 11: 116,545,824 probably benign Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Wnk1 G A 6: 119,950,684 probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
IGL02980:Kif1bp UTSW 10 62559168 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 splice site probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R3848:Kif1bp UTSW 10 62569470 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R4489:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5193:Kif1bp UTSW 10 62559396 missense possibly damaging 0.81
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 splice site probably null
R6513:Kif1bp UTSW 10 62575034 splice site probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R6916:Kif1bp UTSW 10 62566064 missense probably benign 0.05
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
R7376:Kif1bp UTSW 10 62559064 missense possibly damaging 0.89
R7672:Kif1bp UTSW 10 62578073 missense probably benign 0.00
R8134:Kif1bp UTSW 10 62577977 missense probably benign
R8809:Kif1bp UTSW 10 62559712 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTTGCCATACAGACGAGCTACCCG -3'
(R):5'- CCACATTGAAGTTGTCCAGGACCAC -3'

Sequencing Primer
(F):5'- ACGAGCTACCCGGAATTTAG -3'
(R):5'- AAGATGCACAAGCGCAGGAT -3'
Posted On2014-05-23