Incidental Mutation 'R1469:Asap2'
ID197855
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1469 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21213179 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 265 (Q265R)
Ref Sequence ENSEMBL: ENSMUSP00000063217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably benign
Transcript: ENSMUST00000050990
AA Change: Q268R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: Q268R

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064595
AA Change: Q265R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: Q265R

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090834
AA Change: Q268R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: Q268R

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101562
AA Change: Q268R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: Q268R

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.6%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 G A 7: 28,898,266 probably benign Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Antxrl T C 14: 34,067,431 probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cldn16 C A 16: 26,474,180 probably benign Het
Clec7a A C 6: 129,472,572 probably benign Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Itprip A G 19: 47,896,875 Y434H probably damaging Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Limch1 T C 5: 66,881,980 probably benign Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Muc19 T C 15: 91,874,300 noncoding transcript Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Prag1 A T 8: 36,146,298 probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sf3a1 A T 11: 4,175,380 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tmem94 T C 11: 115,795,091 probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ube2o A G 11: 116,545,824 probably benign Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Wnk1 G A 6: 119,950,684 probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7378:Asap2 UTSW 12 21112051 missense probably benign 0.01
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
R8033:Asap2 UTSW 12 21224389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGAAAGCCTCAAGCCTTCC -3'
(R):5'- TGATAGACATGGTCCTGTGAGCCC -3'

Sequencing Primer
(F):5'- CTGGAAACGACTGGTGCTTC -3'
(R):5'- CTGTGAGCCCCTGATAGATAC -3'
Posted On2014-05-23