Incidental Mutation 'R1469:Epha3'
ID197872
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene NameEph receptor A3
SynonymsTyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission 039522-MU
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R1469 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location63543534-63864175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63653494 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 300 (G300D)
Ref Sequence ENSEMBL: ENSMUSP00000066554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049] [ENSMUST00000232461] [ENSMUST00000232654]
Predicted Effect probably damaging
Transcript: ENSMUST00000064405
AA Change: G300D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: G300D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232049
AA Change: G300D

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000232461
Predicted Effect probably damaging
Transcript: ENSMUST00000232654
AA Change: G300D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1619 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.6%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 G A 7: 28,898,266 probably benign Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Antxrl T C 14: 34,067,431 probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cldn16 C A 16: 26,474,180 probably benign Het
Clec7a A C 6: 129,472,572 probably benign Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Itprip A G 19: 47,896,875 Y434H probably damaging Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Limch1 T C 5: 66,881,980 probably benign Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Muc19 T C 15: 91,874,300 noncoding transcript Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Prag1 A T 8: 36,146,298 probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sf3a1 A T 11: 4,175,380 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tmem94 T C 11: 115,795,091 probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ube2o A G 11: 116,545,824 probably benign Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Wnk1 G A 6: 119,950,684 probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1803:Epha3 UTSW 16 63602288 missense probably benign 0.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4223:Epha3 UTSW 16 63583539 missense probably damaging 0.99
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5044:Epha3 UTSW 16 63602287 missense possibly damaging 0.79
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6337:Epha3 UTSW 16 63568443 missense probably damaging 1.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R6908:Epha3 UTSW 16 63598249 missense probably damaging 1.00
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R7938:Epha3 UTSW 16 63773560 missense probably damaging 1.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCATACACACGGTCACGCTTG -3'
(R):5'- CCACATGACTTGCTGCTGTAAACCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacatac -3'
(R):5'- CTGGGAGCAATCTGTTTTACAC -3'
Posted On2014-05-23