Incidental Mutation 'R1470:Tnfrsf11a'
ID 197890
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Name tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms TRANCE-R, Rank
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R1470 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 105780718-105847981 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105825048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 261 (N261S)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
AlphaFold O35305
PDB Structure Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: N261S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: N261S

signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187658
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,261 probably benign Het
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Abcb6 A T 1: 75,172,679 probably benign Het
AC161516.2 G T 5: 67,946,397 probably benign Het
AC238840.1 A T 7: 38,767,953 noncoding transcript Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Acyp2 A G 11: 30,506,452 probably benign Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Afap1 C T 5: 35,961,737 probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Akirin1 T A 4: 123,738,090 probably benign Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Arhgap29 A G 3: 121,992,319 probably benign Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacna1a T A 8: 84,514,950 probably benign Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdc16 A T 8: 13,758,992 probably benign Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Csmd1 G T 8: 16,157,204 probably benign Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Fgd2 T A 17: 29,374,108 probably benign Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrch3 T C 16: 32,988,495 probably benign Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Megf6 C T 4: 154,252,419 probably benign Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myh3 A C 11: 67,098,059 probably benign Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nfkbib T C 7: 28,762,022 probably null Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Orc2 A C 1: 58,481,158 probably benign Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc43a1 T C 2: 84,859,676 probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tex14 T C 11: 87,549,529 probably benign Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tmtc1 T A 6: 148,305,985 probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Traf6 G T 2: 101,696,649 probably benign Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Homo
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Vps50 G A 6: 3,517,777 probably benign Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 splice site probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105844730 missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105844732 missense probably benign 0.02
R7614:Tnfrsf11a UTSW 1 105827369 missense probably damaging 1.00
R7651:Tnfrsf11a UTSW 1 105809446 missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
R8078:Tnfrsf11a UTSW 1 105817684 missense probably damaging 1.00
R8364:Tnfrsf11a UTSW 1 105817687 missense probably damaging 0.99
R8859:Tnfrsf11a UTSW 1 105844518 critical splice acceptor site probably null
R8979:Tnfrsf11a UTSW 1 105827100 missense possibly damaging 0.78
R9008:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R9016:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R9017:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R9052:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
Z1177:Tnfrsf11a UTSW 1 105826999 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggaggaaggaaatgaggagatg -3'
Posted On 2014-05-23