Incidental Mutation 'R1470:Ush2a'
ID197896
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Nameusherin
SynonymsA930011D15Rik, LOC381317, A930037M10Rik, LOC269160, Usherin, MUSH2A
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R1470 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location188262023-188965041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 188400206 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 875 (R875L)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
Predicted Effect probably benign
Transcript: ENSMUST00000060479
AA Change: R875L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: R875L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124358
Meta Mutation Damage Score 0.1210 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,261 probably benign Het
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Abcb6 A T 1: 75,172,679 probably benign Het
AC161516.2 G T 5: 67,946,397 probably benign Het
AC238840.1 A T 7: 38,767,953 noncoding transcript Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Acyp2 A G 11: 30,506,452 probably benign Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Afap1 C T 5: 35,961,737 probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Akirin1 T A 4: 123,738,090 probably benign Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Arhgap29 A G 3: 121,992,319 probably benign Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacna1a T A 8: 84,514,950 probably benign Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdc16 A T 8: 13,758,992 probably benign Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Csmd1 G T 8: 16,157,204 probably benign Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Fgd2 T A 17: 29,374,108 probably benign Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrch3 T C 16: 32,988,495 probably benign Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Megf6 C T 4: 154,252,419 probably benign Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myh3 A C 11: 67,098,059 probably benign Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nfkbib T C 7: 28,762,022 probably null Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Orc2 A C 1: 58,481,158 probably benign Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc43a1 T C 2: 84,859,676 probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tex14 T C 11: 87,549,529 probably benign Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tmtc1 T A 6: 148,305,985 probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Traf6 G T 2: 101,696,649 probably benign Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Homo
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Vps50 G A 6: 3,517,777 probably benign Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188864678 missense probably benign 0.00
IGL00391:Ush2a APN 1 188916061 missense probably damaging 1.00
IGL00429:Ush2a APN 1 188400114 nonsense probably null
IGL00484:Ush2a APN 1 188782513 missense probably benign 0.00
IGL00519:Ush2a APN 1 188444668 missense probably benign 0.03
IGL00567:Ush2a APN 1 188964917 missense probably damaging 1.00
IGL00823:Ush2a APN 1 188911443 missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188357961 nonsense probably null
IGL00951:Ush2a APN 1 188263465 missense probably benign 0.33
IGL00956:Ush2a APN 1 188753522 missense probably damaging 0.99
IGL01096:Ush2a APN 1 188678377 missense probably damaging 1.00
IGL01108:Ush2a APN 1 188862825 missense probably benign 0.00
IGL01315:Ush2a APN 1 188633614 missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188814353 missense probably benign 0.00
IGL01324:Ush2a APN 1 188848992 missense probably benign 0.38
IGL01326:Ush2a APN 1 188263321 nonsense probably null
IGL01384:Ush2a APN 1 188553228 missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188911622 missense probably benign 0.00
IGL01518:Ush2a APN 1 188399785 missense probably benign 0.01
IGL01585:Ush2a APN 1 188430727 missense probably damaging 1.00
IGL01595:Ush2a APN 1 188654724 critical splice donor site probably null
IGL01657:Ush2a APN 1 188826461 missense probably benign 0.03
IGL01797:Ush2a APN 1 188263509 missense probably damaging 1.00
IGL01802:Ush2a APN 1 188436957 missense probably damaging 0.99
IGL01836:Ush2a APN 1 188759863 splice site probably benign
IGL01938:Ush2a APN 1 188797845 missense probably damaging 1.00
IGL01976:Ush2a APN 1 188911241 missense probably benign 0.04
IGL02023:Ush2a APN 1 188733514 missense probably benign 0.03
IGL02126:Ush2a APN 1 188263391 missense probably benign 0.01
IGL02133:Ush2a APN 1 188443343 missense probably damaging 1.00
IGL02147:Ush2a APN 1 188864703 missense probably benign
IGL02275:Ush2a APN 1 188263269 missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188633629 missense probably benign 0.00
IGL02353:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02360:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02367:Ush2a APN 1 188784746 missense probably benign
IGL02402:Ush2a APN 1 188267108 missense probably benign 0.02
IGL02410:Ush2a APN 1 188915997 missense probably damaging 1.00
IGL02490:Ush2a APN 1 188810364 missense probably damaging 1.00
IGL02500:Ush2a APN 1 188822696 missense probably damaging 1.00
IGL02511:Ush2a APN 1 188743687 critical splice donor site probably null
IGL02517:Ush2a APN 1 188915998 missense probably damaging 1.00
IGL02536:Ush2a APN 1 188957266 critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188728333 missense probably benign 0.00
IGL02610:Ush2a APN 1 188444466 missense probably damaging 0.98
IGL02677:Ush2a APN 1 188734685 missense probably damaging 1.00
IGL02691:Ush2a APN 1 188734752 missense probably damaging 1.00
IGL02740:Ush2a APN 1 188648388 missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188358717 splice site probably null
IGL02749:Ush2a APN 1 188946958 missense probably damaging 0.99
IGL02806:Ush2a APN 1 188810357 nonsense probably null
IGL02870:Ush2a APN 1 188678358 missense probably benign 0.42
IGL02894:Ush2a APN 1 188451846 missense probably damaging 1.00
IGL02904:Ush2a APN 1 188906506 missense probably benign 0.06
IGL03000:Ush2a APN 1 188549856 missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188436950 missense probably benign 0.01
IGL03036:Ush2a APN 1 188864621 missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188797838 missense probably damaging 1.00
IGL03230:Ush2a APN 1 188466193 missense probably benign 0.09
IGL03278:Ush2a APN 1 188849116 missense probably damaging 1.00
PIT4283001:Ush2a UTSW 1 188436867 missense probably benign 0.01
R0003:Ush2a UTSW 1 188578491 missense probably damaging 0.99
R0030:Ush2a UTSW 1 188822657 missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188356888 missense probably benign
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188948455 missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0208:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0230:Ush2a UTSW 1 188850104 missense probably damaging 1.00
R0269:Ush2a UTSW 1 188810176 missense probably benign 0.33
R0319:Ush2a UTSW 1 188948374 splice site probably benign
R0358:Ush2a UTSW 1 188537780 missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188451819 missense probably damaging 1.00
R0427:Ush2a UTSW 1 188400281 missense probably damaging 1.00
R0437:Ush2a UTSW 1 188911031 missense probably benign 0.00
R0462:Ush2a UTSW 1 188910939 missense probably benign
R0510:Ush2a UTSW 1 188734663 splice site probably benign
R0531:Ush2a UTSW 1 188443181 missense probably benign 0.18
R0541:Ush2a UTSW 1 188714466 splice site probably benign
R0549:Ush2a UTSW 1 188946953 missense probably damaging 0.99
R0562:Ush2a UTSW 1 188356847 missense probably damaging 1.00
R0636:Ush2a UTSW 1 188822738 missense probably benign
R0662:Ush2a UTSW 1 188351093 missense probably benign 0.26
R0685:Ush2a UTSW 1 188400278 missense probably damaging 1.00
R0718:Ush2a UTSW 1 188797830 missense probably damaging 1.00
R0725:Ush2a UTSW 1 188951525 missense probably damaging 1.00
R0735:Ush2a UTSW 1 188864693 missense probably benign 0.04
R0744:Ush2a UTSW 1 188814406 splice site probably benign
R0765:Ush2a UTSW 1 188948574 missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188542818 nonsense probably null
R1067:Ush2a UTSW 1 188550207 missense probably benign 0.35
R1072:Ush2a UTSW 1 188728717 missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188648348 missense probably benign 0.06
R1099:Ush2a UTSW 1 188864639 missense probably damaging 1.00
R1104:Ush2a UTSW 1 188916256 missense probably benign
R1106:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188753536 missense probably damaging 0.99
R1168:Ush2a UTSW 1 188678411 missense probably benign 0.01
R1199:Ush2a UTSW 1 188759795 missense probably benign 0.00
R1215:Ush2a UTSW 1 188957282 missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188357967 missense probably damaging 1.00
R1307:Ush2a UTSW 1 188451840 missense probably damaging 1.00
R1311:Ush2a UTSW 1 188947145 missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188523318 splice site probably benign
R1416:Ush2a UTSW 1 188436883 missense probably damaging 1.00
R1424:Ush2a UTSW 1 188542878 critical splice donor site probably null
R1459:Ush2a UTSW 1 188862851 missense probably benign 0.05
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1477:Ush2a UTSW 1 188849076 missense probably benign 0.05
R1484:Ush2a UTSW 1 188810337 nonsense probably null
R1490:Ush2a UTSW 1 188359841 missense probably benign 0.24
R1510:Ush2a UTSW 1 188648304 missense probably damaging 1.00
R1522:Ush2a UTSW 1 188797814 missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188759766 missense probably benign 0.17
R1618:Ush2a UTSW 1 188814224 missense probably benign 0.29
R1636:Ush2a UTSW 1 188466176 missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188415821 missense probably damaging 1.00
R1660:Ush2a UTSW 1 188916064 missense probably benign
R1676:Ush2a UTSW 1 188728585 missense probably damaging 1.00
R1704:Ush2a UTSW 1 188821796 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188874869 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188911541 missense probably benign 0.40
R1760:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188728203 missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188911185 missense probably benign 0.06
R1794:Ush2a UTSW 1 188862809 missense probably benign 0.00
R1796:Ush2a UTSW 1 188910827 missense probably benign 0.11
R1804:Ush2a UTSW 1 188633729 critical splice donor site probably null
R1835:Ush2a UTSW 1 188451818 missense probably benign 0.13
R1871:Ush2a UTSW 1 188826468 missense probably benign 0.02
R1876:Ush2a UTSW 1 188678289 missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188399980 missense probably benign 0.05
R1896:Ush2a UTSW 1 188550009 missense probably benign 0.00
R1907:Ush2a UTSW 1 188715064 missense probably benign 0.01
R1940:Ush2a UTSW 1 188951561 missense probably null 0.89
R1950:Ush2a UTSW 1 188755185 missense probably damaging 1.00
R1991:Ush2a UTSW 1 188578532 splice site probably benign
R2043:Ush2a UTSW 1 188916256 missense probably benign 0.00
R2046:Ush2a UTSW 1 188356927 missense probably benign 0.01
R2059:Ush2a UTSW 1 188381549 critical splice donor site probably null
R2239:Ush2a UTSW 1 188576214 missense probably benign
R2365:Ush2a UTSW 1 188378991 missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188947040 missense probably damaging 1.00
R2425:Ush2a UTSW 1 188537804 missense possibly damaging 0.82
R2519:Ush2a UTSW 1 188267107 missense probably benign
R3039:Ush2a UTSW 1 188911547 missense probably damaging 0.99
R3434:Ush2a UTSW 1 188733758 missense probably damaging 1.00
R3711:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3712:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3732:Ush2a UTSW 1 188944760 missense probably benign 0.16
R3746:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3747:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3883:Ush2a UTSW 1 188263382 missense probably benign
R3911:Ush2a UTSW 1 188399954 missense probably benign 0.05
R3934:Ush2a UTSW 1 188263511 critical splice donor site probably null
R3946:Ush2a UTSW 1 188728504 missense probably benign 0.01
R3974:Ush2a UTSW 1 188381501 missense probably benign 0.06
R4158:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4159:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4161:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4162:Ush2a UTSW 1 188743680 missense probably benign 0.00
R4255:Ush2a UTSW 1 188759843 nonsense probably null
R4280:Ush2a UTSW 1 188578461 missense probably benign 0.16
R4387:Ush2a UTSW 1 188443431 missense probably benign 0.00
R4416:Ush2a UTSW 1 188356874 missense probably damaging 0.97
R4494:Ush2a UTSW 1 188553276 missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188728596 missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188864625 missense probably damaging 1.00
R4584:Ush2a UTSW 1 188451798 missense probably benign 0.00
R4599:Ush2a UTSW 1 188911647 missense probably benign 0.01
R4605:Ush2a UTSW 1 188910801 missense probably damaging 1.00
R4632:Ush2a UTSW 1 188395874 missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188399941 missense probably benign 0.01
R4751:Ush2a UTSW 1 188850087 missense probably damaging 0.98
R4770:Ush2a UTSW 1 188549879 missense probably benign 0.25
R4771:Ush2a UTSW 1 188797769 missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188743545 missense probably damaging 1.00
R4821:Ush2a UTSW 1 188753651 missense probably benign 0.32
R4857:Ush2a UTSW 1 188537720 missense probably benign 0.01
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4898:Ush2a UTSW 1 188626608 missense probably benign 0.37
R4993:Ush2a UTSW 1 188910720 missense probably benign 0.03
R5035:Ush2a UTSW 1 188910808 missense probably damaging 1.00
R5061:Ush2a UTSW 1 188957274 missense probably benign 0.03
R5150:Ush2a UTSW 1 188451870 missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188874936 missense probably benign 0.21
R5212:Ush2a UTSW 1 188444705 critical splice donor site probably null
R5252:Ush2a UTSW 1 188821717 missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188947079 missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188356798 missense probably damaging 0.99
R5323:Ush2a UTSW 1 188821677 critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5331:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5332:Ush2a UTSW 1 188351079 missense probably damaging 1.00
R5371:Ush2a UTSW 1 188443070 missense probably benign 0.00
R5374:Ush2a UTSW 1 188755206 missense probably benign
R5377:Ush2a UTSW 1 188912123 missense probably benign 0.00
R5525:Ush2a UTSW 1 188753606 missense probably benign 0.01
R5558:Ush2a UTSW 1 188797827 missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188576217 missense probably damaging 1.00
R5595:Ush2a UTSW 1 188906498 missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188759823 missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188400257 missense probably benign 0.00
R5743:Ush2a UTSW 1 188436962 missense probably benign 0.01
R5779:Ush2a UTSW 1 188443510 critical splice donor site probably null
R5795:Ush2a UTSW 1 188443397 missense probably benign 0.34
R5897:Ush2a UTSW 1 188821738 missense probably damaging 1.00
R5918:Ush2a UTSW 1 188356814 missense probably benign 0.26
R6000:Ush2a UTSW 1 188267026 nonsense probably null
R6014:Ush2a UTSW 1 188850040 missense probably damaging 0.98
R6017:Ush2a UTSW 1 188957514 critical splice donor site probably null
R6020:Ush2a UTSW 1 188728096 splice site probably null
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188957324 missense probably benign 0.06
R6083:Ush2a UTSW 1 188267023 missense probably damaging 1.00
R6091:Ush2a UTSW 1 188399803 missense probably damaging 1.00
R6120:Ush2a UTSW 1 188358603 missense probably benign 0.04
R6135:Ush2a UTSW 1 188912106 missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188357963 missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188728270 missense probably benign 0.00
R6180:Ush2a UTSW 1 188399871 nonsense probably null
R6191:Ush2a UTSW 1 188263101 nonsense probably null
R6217:Ush2a UTSW 1 188743454 intron probably null
R6263:Ush2a UTSW 1 188358642 missense probably damaging 1.00
R6294:Ush2a UTSW 1 188536370 missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188356846 missense probably benign 0.01
R6321:Ush2a UTSW 1 188849046 nonsense probably null
R6347:Ush2a UTSW 1 188910887 missense probably benign
R6382:Ush2a UTSW 1 188814302 missense probably benign 0.01
R6408:Ush2a UTSW 1 188267032 nonsense probably null
R6418:Ush2a UTSW 1 188628566 missense probably damaging 1.00
R6500:Ush2a UTSW 1 188841527 missense probably benign 0.00
R6504:Ush2a UTSW 1 188911247 missense probably benign 0.00
R6534:Ush2a UTSW 1 188451802 nonsense probably null
R6594:Ush2a UTSW 1 188910798 missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188911397 missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188523331 missense probably damaging 0.99
R6658:Ush2a UTSW 1 188814359 missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188753684 missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188443219 missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188356834 missense probably benign
R6817:Ush2a UTSW 1 188862864 missense probably benign 0.03
R6834:Ush2a UTSW 1 188356792 missense probably damaging 1.00
R6851:Ush2a UTSW 1 188533205 missense probably benign 0.06
R6853:Ush2a UTSW 1 188911237 nonsense probably null
R6867:Ush2a UTSW 1 188910973 missense probably damaging 1.00
R6889:Ush2a UTSW 1 188797871 missense probably damaging 1.00
R6931:Ush2a UTSW 1 188728383 missense probably benign 0.01
R6953:Ush2a UTSW 1 188263145 missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188576244 missense probably damaging 1.00
R7109:Ush2a UTSW 1 188381484 missense probably benign 0.19
R7153:Ush2a UTSW 1 188728484 missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188537728 missense probably benign 0.00
R7182:Ush2a UTSW 1 188753543 missense probably benign 0.01
R7201:Ush2a UTSW 1 188874754 missense probably benign
R7223:Ush2a UTSW 1 188810217 missense probably benign 0.09
R7231:Ush2a UTSW 1 188759763 missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188911661 missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188443329 missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188553198 missense probably damaging 0.97
R7343:Ush2a UTSW 1 188415746 missense probably benign 0.00
R7352:Ush2a UTSW 1 188466124 missense probably benign 0.04
R7384:Ush2a UTSW 1 188400163 missense probably damaging 0.99
R7391:Ush2a UTSW 1 188962008 small deletion probably benign
R7394:Ush2a UTSW 1 188911416 missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188633727 missense probably damaging 1.00
R7408:Ush2a UTSW 1 188733529 missense probably benign 0.00
R7453:Ush2a UTSW 1 188553111 missense probably damaging 1.00
R7496:Ush2a UTSW 1 188351087 missense possibly damaging 0.50
R7552:Ush2a UTSW 1 188267044 missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188957493 missense probably benign 0.31
R7575:Ush2a UTSW 1 188822688 missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188549913 missense probably damaging 1.00
R7584:Ush2a UTSW 1 188728109 critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188542849 missense probably benign 0.00
R7602:Ush2a UTSW 1 188648409 missense probably damaging 1.00
R7670:Ush2a UTSW 1 188784708 missense possibly damaging 0.78
U24488:Ush2a UTSW 1 188430766 missense probably damaging 0.99
X0011:Ush2a UTSW 1 188318969 missense probably benign 0.00
X0024:Ush2a UTSW 1 188400282 missense probably damaging 1.00
X0026:Ush2a UTSW 1 188319025 missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188549854 missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188911983 missense probably benign
Z1088:Ush2a UTSW 1 188947004 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTGCCAATGTAACCTCCACGGCTC -3'
(R):5'- TTACCTGGCTGACACTGCTCACAC -3'

Sequencing Primer
(F):5'- GCTCAGTGAACCAACTCTGTG -3'
(R):5'- GACACTGCTCACACCTTCTTC -3'
Posted On2014-05-23