Incidental Mutation 'R0084:Acvr1'
ID19791
Institutional Source Beutler Lab
Gene Symbol Acvr1
Ensembl Gene ENSMUSG00000026836
Gene Nameactivin A receptor, type 1
SynonymsAlk-2, ActR-I, Acvrlk2, SKR1, ALK2, Tsk7L, D330013D15Rik, Acvr, ActRIA, Alk8
MMRRC Submission 038371-MU
Accession Numbers

Genbank: NM_007394; MGI: 87911

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58388644-58567157 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 58458883 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056376] [ENSMUST00000090935] [ENSMUST00000112599] [ENSMUST00000112601]
Predicted Effect probably null
Transcript: ENSMUST00000056376
SMART Domains Protein: ENSMUSP00000056784
Gene: ENSMUSG00000026836

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000090935
SMART Domains Protein: ENSMUSP00000088453
Gene: ENSMUSG00000026836

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112599
SMART Domains Protein: ENSMUSP00000108218
Gene: ENSMUSG00000026836

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 1.4e-13 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112601
SMART Domains Protein: ENSMUSP00000108220
Gene: ENSMUSG00000026836

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145495
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth arrest and complete embryonic lethality due to gastrulation defects associated with abnormalities in primitive streak formation, embryonic epiblast morphology, and mesoderm and ectoderm development. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Acvr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Acvr1 APN 2 58447573 missense probably benign 0.00
IGL01392:Acvr1 APN 2 58500546 missense probably benign 0.01
IGL01526:Acvr1 APN 2 58458985 missense probably benign 0.20
IGL02524:Acvr1 APN 2 58448307 splice site probably benign
IGL02682:Acvr1 APN 2 58477811 missense probably benign 0.00
IGL02795:Acvr1 APN 2 58462952 missense probably damaging 1.00
R0452:Acvr1 UTSW 2 58500495 missense probably benign 0.13
R0746:Acvr1 UTSW 2 58500550 start codon destroyed probably null 0.01
R1484:Acvr1 UTSW 2 58479889 missense probably damaging 1.00
R1514:Acvr1 UTSW 2 58447585 nonsense probably null
R1645:Acvr1 UTSW 2 58462899 missense probably damaging 1.00
R1925:Acvr1 UTSW 2 58447649 missense probably damaging 0.99
R2435:Acvr1 UTSW 2 58479692 missense probably damaging 1.00
R2873:Acvr1 UTSW 2 58477796 nonsense probably null
R3729:Acvr1 UTSW 2 58462913 missense probably null 0.09
R3854:Acvr1 UTSW 2 58462934 missense probably damaging 1.00
R4438:Acvr1 UTSW 2 58477727 missense probably benign 0.00
R4863:Acvr1 UTSW 2 58477711 missense possibly damaging 0.60
R5543:Acvr1 UTSW 2 58463145 missense probably damaging 1.00
R5558:Acvr1 UTSW 2 58459017 missense probably damaging 1.00
R5618:Acvr1 UTSW 2 58462943 missense probably damaging 1.00
R6233:Acvr1 UTSW 2 58448399 missense probably benign 0.04
R6236:Acvr1 UTSW 2 58477666 missense probably benign 0.17
R6565:Acvr1 UTSW 2 58479757 missense probably damaging 1.00
R6912:Acvr1 UTSW 2 58447573 missense probably benign 0.00
R7739:Acvr1 UTSW 2 58462971 missense possibly damaging 0.47
R7912:Acvr1 UTSW 2 58474218 missense probably damaging 0.97
R7993:Acvr1 UTSW 2 58474218 missense probably damaging 0.97
Z1176:Acvr1 UTSW 2 58479868 missense not run
Predicted Primers PCR Primer
(F):5'- ACAGCAGGACGCTTCCATAAGATTC -3'
(R):5'- TCAGTGTCGCACATACCACCAGAG -3'

Sequencing Primer
(F):5'- TAAATCTAGCTTATGGAGGAACAAAG -3'
(R):5'- TGGCAGTCATGCATTCCCAG -3'
Posted On2013-04-11