Mutagenetix > Incidental Mutation

Incidental Mutation 'R1470:Lrba'

197917

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

039523-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1470 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86737142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 381 (H381Y)

Ref Sequence

ENSEMBL: ENSMUSP00000141734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107635
AA Change: H2477Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: H2477Y

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192145
AA Change: H2477Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: H2477Y

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000194759
AA Change: H2477Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: H2477Y

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000195524
AA Change: H381Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080
AA Change: H381Y

Domain	Start	End	E-Value	Type
Pfam:PH_BEACH	3	76	3.6e-20	PFAM
Beach	107	384	2.87e-207	SMART
WD40	482	519	7.4e0	SMART
WD40	522	565	1.72e0	SMART
WD40	581	620	3.99e-1	SMART
WD40	664	702	1.79e-1	SMART
WD40	705	744	4.28e0	SMART

Meta Mutation Damage Score

0.8577

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.0%

Validation Efficiency

97% (125/129)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 142 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	T	C	15: 98,585,261		probably benign	Het
4932438A13Rik	T	C	3: 36,998,331	M3060T	probably benign	Het
Aak1	T	A	6: 86,967,355	S749T	unknown	Het
Abcb4	A	T	5: 8,940,968	I843F	probably damaging	Het
Abcb6	A	T	1: 75,172,679		probably benign	Het
AC161516.2	G	T	5: 67,946,397		probably benign	Het
AC238840.1	A	T	7: 38,767,953		noncoding transcript	Het
Actr8	T	A	14: 29,986,969	H244Q	possibly damaging	Het
Acyp2	A	G	11: 30,506,452		probably benign	Het
Adgrv1	A	G	13: 81,382,298	Y5886H	probably benign	Het
Afap1	C	T	5: 35,961,737		probably benign	Het
Agk	T	A	6: 40,386,817	W244R	probably damaging	Het
Akirin1	T	A	4: 123,738,090		probably benign	Het
Ankrd11	C	A	8: 122,899,724	V161L	probably damaging	Het
Arap3	T	C	18: 37,989,196		probably null	Het
Arhgap29	A	G	3: 121,992,319		probably benign	Het
Armc3	A	G	2: 19,238,736	M88V	probably benign	Het
Atp13a5	G	T	16: 29,349,015	P109T	probably benign	Het
Avpr1b	T	A	1: 131,600,585	V282D	probably damaging	Het
Baz2b	T	C	2: 59,978,546	K120E	possibly damaging	Het
Cacna1a	T	A	8: 84,514,950		probably benign	Het
Cacng6	G	A	7: 3,424,888	C76Y	probably damaging	Het
Cactin	G	T	10: 81,323,151	E279*	probably null	Het
Car9	A	G	4: 43,510,222	Y268C	probably damaging	Het
Ccdc146	T	A	5: 21,319,566	I263F	probably damaging	Het
Cdc16	A	T	8: 13,758,992		probably benign	Het
Cdh16	T	G	8: 104,618,371	S429R	probably benign	Het
Cep250	A	G	2: 155,991,075	E1639G	probably damaging	Het
Ces1d	A	T	8: 93,195,021	V38D	possibly damaging	Het
Chd1	A	T	17: 15,726,283	Q97L	possibly damaging	Het
Ciita	G	A	16: 10,514,468	D898N	possibly damaging	Het
Clstn1	A	G	4: 149,634,722	N336S	possibly damaging	Het
Cntnap5a	A	G	1: 116,259,519	D607G	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col20a1	C	T	2: 180,994,960	H245Y	probably benign	Het
Coq8b	A	T	7: 27,252,309	T399S	probably benign	Het
Cpn2	A	G	16: 30,260,185	S233P	probably benign	Het
Cryz	G	A	3: 154,606,476	G70D	probably damaging	Het
Csmd1	G	T	8: 16,157,204		probably benign	Het
Def6	T	A	17: 28,225,982	D451E	possibly damaging	Het
Dnah8	T	A	17: 30,747,277	C2480*	probably null	Het
Dnah9	T	C	11: 65,927,822	N3230S	probably benign	Het
Dyrk4	G	T	6: 126,916,374	S15*	probably null	Het
Erc1	T	C	6: 119,694,602	R917G	probably damaging	Het
Fgd2	T	A	17: 29,374,108		probably benign	Het
Frem3	G	T	8: 80,611,191	V38L	probably benign	Het
Gas2l3	T	C	10: 89,413,934	I441V	probably benign	Het
Gm14393	T	A	2: 175,063,981	Y6F	probably damaging	Het
Gm1527	A	G	3: 28,915,268	K256E	possibly damaging	Het
Gtf2ird1	T	A	5: 134,395,802		probably null	Het
Hmces	C	A	6: 87,936,139	T292K	probably benign	Het
Hpse2	G	A	19: 43,388,253	S20L	probably benign	Het
Ikbke	A	T	1: 131,276,487	V23E	probably null	Het
Ino80	A	T	2: 119,379,649	V1387E	probably damaging	Het
Islr	G	T	9: 58,157,306	A306D	probably damaging	Het
Jakmip1	G	A	5: 37,100,838	G276D	probably damaging	Het
Jchain	A	G	5: 88,526,120	V55A	probably benign	Het
Kalrn	T	C	16: 34,187,471	K1350E	probably damaging	Het
Kansl1l	T	C	1: 66,801,997	Q48R	possibly damaging	Het
Kmt5a	T	C	5: 124,447,271	L23P	probably damaging	Het
Lrch3	T	C	16: 32,988,495		probably benign	Het
Lrrc32	T	C	7: 98,499,357	V448A	probably benign	Het
Mapkbp1	T	C	2: 120,017,820	M617T	probably damaging	Het
Megf6	C	T	4: 154,252,419		probably benign	Het
Mfap1a	T	C	2: 121,502,801	M50V	probably benign	Het
Mgam	G	T	6: 40,759,128	A854S	probably damaging	Het
Myh3	A	C	11: 67,098,059		probably benign	Het
Myo18b	C	A	5: 112,693,033	R2298L	probably damaging	Het
Myo1h	T	A	5: 114,319,704	M92K	probably damaging	Het
Nfkbib	T	C	7: 28,762,022		probably null	Het
Nlrp2	T	A	7: 5,300,951	T192S	probably benign	Het
Nr2f1	A	T	13: 78,198,165	Y137N	possibly damaging	Het
Nup98	T	A	7: 102,147,306	D841V	probably damaging	Het
Nvl	A	G	1: 181,139,262	V59A	probably damaging	Het
Ogdhl	C	A	14: 32,346,788	N948K	probably damaging	Het
Olfr530	A	G	7: 140,373,113	S166P	probably benign	Het
Olfr538	A	G	7: 140,574,749	T199A	probably benign	Het
Olfr578	A	C	7: 102,984,323	Y280*	probably null	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Orc2	A	C	1: 58,481,158		probably benign	Het
Osgin1	G	A	8: 119,444,965	R166H	probably damaging	Het
Palb2	A	T	7: 122,107,523	F741I	probably benign	Het
Palb2	G	T	7: 122,107,524	Y740*	probably null	Het
Parvb	G	A	15: 84,271,252	G46D	probably damaging	Het
Parvb	G	A	15: 84,271,308	D65N	probably benign	Het
Pcsk2	A	T	2: 143,546,518	K10*	probably null	Het
Pde3a	C	T	6: 141,466,206	A502V	probably benign	Het
Pfas	T	C	11: 68,991,359	I893V	probably benign	Het
Pla2g4a	A	T	1: 149,840,720	D663E	probably damaging	Het
Prickle2	G	A	6: 92,458,602	P6L	probably damaging	Het
Prx	T	A	7: 27,517,601	M648K	probably benign	Het
Ptpn21	T	C	12: 98,688,476	N744S	probably benign	Het
Ptprq	C	T	10: 107,718,574	V97M	probably damaging	Het
Pvr	T	C	7: 19,918,624	E122G	possibly damaging	Het
Racgap1	T	C	15: 99,639,775	K15E	probably damaging	Het
Rock1	C	T	18: 10,136,091		probably null	Het
Rorc	T	A	3: 94,397,302	Y331*	probably null	Het
Rpl37	T	C	15: 5,118,614	V91A	probably benign	Het
Rrp36	T	A	17: 46,672,380	K103*	probably null	Het
Ryr3	T	A	2: 112,653,007	M4142L	probably benign	Het
Sash1	A	T	10: 8,789,593	L125H	probably damaging	Het
Scn5a	T	C	9: 119,536,475	M369V	possibly damaging	Het
Siglec1	A	T	2: 131,070,387	N1678K	probably benign	Het
Slc15a5	A	T	6: 138,072,994	V141E	probably benign	Het
Slc43a1	T	C	2: 84,859,676		probably benign	Het
Slc8a3	A	T	12: 81,199,710	H856Q	probably benign	Het
Sptlc2	T	A	12: 87,355,640	M171L	probably benign	Het
Srcap	T	A	7: 127,559,727		probably benign	Het
St6gal2	A	G	17: 55,490,943	D310G	probably damaging	Het
Susd2	T	A	10: 75,638,054	D689V	probably damaging	Het
Suz12	A	T	11: 80,019,732	E303V	possibly damaging	Het
Taldo1	C	A	7: 141,398,587	T150K	probably damaging	Het
Tex14	T	C	11: 87,549,529		probably benign	Het
Tg	T	A	15: 66,849,463	F274I	possibly damaging	Het
Tmem151b	T	C	17: 45,545,737	D259G	probably damaging	Het
Tmem179	G	T	12: 112,501,854	H64Q	probably benign	Het
Tmem236	A	G	2: 14,218,921	T174A	probably benign	Het
Tmtc1	T	A	6: 148,305,985		probably benign	Het
Tnc	A	T	4: 63,966,574	N1821K	probably damaging	Het
Tnfrsf11a	A	G	1: 105,825,048	N261S	probably damaging	Het
Traf6	G	T	2: 101,696,649		probably benign	Het
Trank1	C	A	9: 111,343,232	F96L	possibly damaging	Het
Trim56	T	A	5: 137,113,163	I500F	probably damaging	Het
Ttc30b	G	T	2: 75,937,811	S199R	probably benign	Het
Ttll5	A	G	12: 85,879,394	I321V	possibly damaging	Het
Ttn	C	A	2: 76,778,023	W17852L	probably damaging	Het
Twnk	G	A	19: 45,009,381	V450M	probably damaging	Het
Uba52	A	G	8: 70,509,556	I127T	possibly damaging	Het
Ubr4	T	A	4: 139,421,226		probably null	Het
Uggt1	A	T	1: 36,176,796	M130K	probably benign	Het
Ulk4	T	A	9: 121,081,656	T1101S	probably benign	Het
Urb1	A	G	16: 90,752,014	S2269P	probably benign	Het
Ush2a	G	T	1: 188,400,206	R875L	probably benign	Het
Usp9y	T	A	Y: 1,332,471	H1624L	probably benign	Homo
Vipr1	T	C	9: 121,665,520	L308S	possibly damaging	Het
Vps50	G	A	6: 3,517,777		probably benign	Het
Xdh	T	G	17: 73,891,112	K1260T	probably damaging	Het
Yipf4	A	G	17: 74,493,968	I94V	probably benign	Het
Zfhx4	A	G	3: 5,413,146	*3582W	probably null	Het
Zfp58	T	C	13: 67,492,025	N116D	possibly damaging	Het
Zfp750	C	A	11: 121,511,993	R643L	probably benign	Het
Znfx1	A	G	2: 167,042,587	V51A	possibly damaging	Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0417:Lrba	UTSW	3	86715654	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	splice site	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2186:Lrba	UTSW	3	86304336	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	splice site	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	splice site	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7350:Lrba	UTSW	3	86351902	missense	probably damaging	0.96
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7855:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
R8090:Lrba	UTSW	3	86348489	missense	probably benign
R8111:Lrba	UTSW	3	86327705	missense	probably damaging	1.00
R8118:Lrba	UTSW	3	86354226	missense	probably benign
R8204:Lrba	UTSW	3	86315403	missense	possibly damaging	0.95
R8239:Lrba	UTSW	3	86542575	missense	probably damaging	1.00
R8509:Lrba	UTSW	3	86348176	missense	probably benign	0.04
R8532:Lrba	UTSW	3	86757483	missense	probably damaging	1.00
R8726:Lrba	UTSW	3	86353755	missense	probably benign
R8744:Lrba	UTSW	3	86304333	missense	probably benign	0.08
R8782:Lrba	UTSW	3	86642669	missense	probably benign	0.00
R8784:Lrba	UTSW	3	86375928	missense	probably damaging	1.00
R8922:Lrba	UTSW	3	86356666	missense	probably damaging	1.00
R8964:Lrba	UTSW	3	86351245	missense	probably benign	0.22
R8971:Lrba	UTSW	3	86615081	missense	probably benign	0.00
R9046:Lrba	UTSW	3	86395236	missense	possibly damaging	0.94
R9155:Lrba	UTSW	3	86295201	missense	probably damaging	1.00
R9236:Lrba	UTSW	3	86353759	missense	probably benign	0.05
R9266:Lrba	UTSW	3	86291467	missense	probably benign	0.08
R9297:Lrba	UTSW	3	86373566	missense	probably damaging	1.00
R9404:Lrba	UTSW	3	86297917	missense	probably damaging	0.99
R9617:Lrba	UTSW	3	86359862	missense	probably benign
R9640:Lrba	UTSW	3	86619568	nonsense	probably null
R9779:Lrba	UTSW	3	86325771	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGTAGCATGACCTCACCCAGG -3'
(R):5'- TGCAACAGAAACCACGAGCTGATG -3'

Sequencing Primer
(F):5'- TCCCGTAGAAACATGGGTTG -3'
(R):5'- GTGAGCACTGTAGCTAAATTTGC -3'

Posted On

2014-05-23