Incidental Mutation 'R1470:Jakmip1'
ID 197930
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name
Synonyms Gababrbp, C330021K24Rik, Marlin-1, 5830437M04Rik
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R1470 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 37113784-37117473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37100838 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 276 (G276D)
Ref Sequence ENSEMBL: ENSMUSP00000156188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043794] [ENSMUST00000121010] [ENSMUST00000137019] [ENSMUST00000174629] [ENSMUST00000232332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043794
AA Change: G276D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038504
Gene: ENSMUSG00000063646
AA Change: G276D

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
low complexity region 467 487 N/A INTRINSIC
coiled coil region 515 604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121010
AA Change: G276D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113624
Gene: ENSMUSG00000063646
AA Change: G276D

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
Pfam:JAKMIP_CC3 415 612 3.3e-85 PFAM
coiled coil region 678 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137019
AA Change: G276D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122584
Gene: ENSMUSG00000063646
AA Change: G276D

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174629
AA Change: G111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134288
Gene: ENSMUSG00000063646
AA Change: G111D

DomainStartEndE-ValueType
coiled coil region 13 52 N/A INTRINSIC
coiled coil region 119 212 N/A INTRINSIC
low complexity region 282 302 N/A INTRINSIC
coiled coil region 330 422 N/A INTRINSIC
coiled coil region 493 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232332
AA Change: G276D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,261 probably benign Het
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Abcb6 A T 1: 75,172,679 probably benign Het
AC161516.2 G T 5: 67,946,397 probably benign Het
AC238840.1 A T 7: 38,767,953 noncoding transcript Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Acyp2 A G 11: 30,506,452 probably benign Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Afap1 C T 5: 35,961,737 probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Akirin1 T A 4: 123,738,090 probably benign Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Arhgap29 A G 3: 121,992,319 probably benign Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacna1a T A 8: 84,514,950 probably benign Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdc16 A T 8: 13,758,992 probably benign Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Csmd1 G T 8: 16,157,204 probably benign Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Fgd2 T A 17: 29,374,108 probably benign Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrch3 T C 16: 32,988,495 probably benign Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Megf6 C T 4: 154,252,419 probably benign Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myh3 A C 11: 67,098,059 probably benign Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nfkbib T C 7: 28,762,022 probably null Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Orc2 A C 1: 58,481,158 probably benign Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc43a1 T C 2: 84,859,676 probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
Srcap T A 7: 127,559,727 probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tex14 T C 11: 87,549,529 probably benign Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tmtc1 T A 6: 148,305,985 probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Traf6 G T 2: 101,696,649 probably benign Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Homo
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Vps50 G A 6: 3,517,777 probably benign Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37085406 nonsense probably null
IGL01350:Jakmip1 APN 5 37085431 missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37100768 missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37120980 missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37120987 missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37104856 missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37100843 nonsense probably null
R0036:Jakmip1 UTSW 5 37134304 missense probably null 0.38
R0194:Jakmip1 UTSW 5 37134283 missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37135553 splice site probably null
R0555:Jakmip1 UTSW 5 37118873 missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37134249 missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37091128 missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37091199 missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37100743 missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37141805 nonsense probably null
R2973:Jakmip1 UTSW 5 37091527 missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37128622 missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37091275 missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37104901 missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37107268 missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37085280 unclassified probably benign
R6258:Jakmip1 UTSW 5 37141760 nonsense probably null
R6776:Jakmip1 UTSW 5 37187154 missense probably damaging 0.97
R6880:Jakmip1 UTSW 5 37105623 missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37173353 missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37124941 missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37174765 nonsense probably null
R7173:Jakmip1 UTSW 5 37091364 missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37127473 missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37117460 missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37118804 missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37173207 missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37175154 missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37173571 missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37127458 missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37171001 missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37134273 missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37117497 missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37175180 missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R7942:Jakmip1 UTSW 5 37173838 missense probably benign 0.01
R7949:Jakmip1 UTSW 5 37182148 missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37159765 missense unknown
R8039:Jakmip1 UTSW 5 37100772 missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37154644 missense unknown
R8070:Jakmip1 UTSW 5 37173287 missense probably benign 0.10
R8410:Jakmip1 UTSW 5 37117484 missense possibly damaging 0.91
R8779:Jakmip1 UTSW 5 37229328 missense unknown
R8946:Jakmip1 UTSW 5 37185740 critical splice donor site probably null
R8992:Jakmip1 UTSW 5 37117538 missense probably benign 0.23
R9007:Jakmip1 UTSW 5 37175513 missense probably benign 0.04
RF014:Jakmip1 UTSW 5 37174526 missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37118903 missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37120986 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37091583 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37175307 frame shift probably null
Z1190:Jakmip1 UTSW 5 37173964 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCCAGAGTCTGACAGGGACACC -3'
(R):5'- CTGAGCCTGGCACACACTGAATATC -3'

Sequencing Primer
(F):5'- TTCCCTGTACCAGATGGACG -3'
(R):5'- ctccctccttccctccttc -3'
Posted On 2014-05-23