Incidental Mutation 'R0084:Ovol2'
ID19794
Institutional Source Beutler Lab
Gene Symbol Ovol2
Ensembl Gene ENSMUSG00000037279
Gene Nameovo like zinc finger 2
SynonymsM-OVO, movo2, M-OVO-A, M-OVO-B, Ovol2, Zfp339
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144305175-144332146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144305888 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 180 (N180K)
Ref Sequence ENSEMBL: ENSMUSP00000044026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037423] [ENSMUST00000103171]
Predicted Effect probably damaging
Transcript: ENSMUST00000037423
AA Change: N180K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044026
Gene: ENSMUSG00000037279
AA Change: N180K

DomainStartEndE-ValueType
low complexity region 46 74 N/A INTRINSIC
ZnF_C2H2 118 140 3.34e-2 SMART
ZnF_C2H2 146 168 2.09e-3 SMART
ZnF_C2H2 174 197 2.27e-4 SMART
ZnF_C2H2 213 236 6.67e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103171
AA Change: N147K

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099460
Gene: ENSMUSG00000037279
AA Change: N147K

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
ZnF_C2H2 85 107 3.34e-2 SMART
ZnF_C2H2 113 135 2.09e-3 SMART
ZnF_C2H2 141 164 2.27e-4 SMART
ZnF_C2H2 180 203 6.67e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the evolutionarily conserved ovo-like protein family. Mammalian members of this family contain a single zinc finger domain composed of a tetrad of C2H2 zinc fingers with variable N- and C-terminal extensions that contain intrinsically disordered domains. Members of this family are involved in epithelial development and differentiation. Knockout of this gene in mouse results in early embryonic lethality with phenotypes that include neurectoderm expansion, impaired vascularization, and heart anomalies. In humans, allelic variants of this gene have been associated with posterior polymorphous corneal dystrophy. [provided by RefSeq, Apr 2016]
PHENOTYPE: Embryos homozygous for a null allele are small and die at E9.5-E10.5 with an open neural tube, impaired extraembryonic and embryonic vascularization, abnormal cardiogenesis and placental defects. Homozygotes for another null allele die by E10.5 with brain, neural crest, gut tube and heart anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Ovol2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ovol2 APN 2 144305679 missense probably damaging 1.00
IGL02166:Ovol2 APN 2 144305730 missense possibly damaging 0.95
boh UTSW 2 144317860 missense probably damaging 1.00
R0760:Ovol2 UTSW 2 144331759 critical splice donor site probably null
R0883:Ovol2 UTSW 2 144331790 missense probably damaging 0.99
R1672:Ovol2 UTSW 2 144305790 missense probably damaging 1.00
R3410:Ovol2 UTSW 2 144317876 missense probably benign 0.00
R4780:Ovol2 UTSW 2 144331283 intron probably benign
R5127:Ovol2 UTSW 2 144317860 missense probably damaging 1.00
R7432:Ovol2 UTSW 2 144317872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGAGAAATGTGCTCCCTGGATGG -3'
(R):5'- GACCTGGCTGATAAAAGACGAGACC -3'

Sequencing Primer
(F):5'- GGTCACTGTTCACATGCAGATAC -3'
(R):5'- TCTCTCCCAGAGCCAAGTG -3'
Posted On2013-04-11