Incidental Mutation 'R1470:Srcap'
ID197962
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene NameSnf2-related CREBBP activator protein
SynonymsD030022P06Rik, F630004O05Rik, B930091H02Rik
MMRRC Submission 039523-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1470 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127511983-127561219 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 127559727 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000084563] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000189629] [ENSMUST00000190278] [ENSMUST00000190390]
Predicted Effect probably benign
Transcript: ENSMUST00000084563
SMART Domains Protein: ENSMUSP00000081611
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
AT_hook 62 74 4.04e0 SMART
low complexity region 114 134 N/A INTRINSIC
AT_hook 142 154 4.46e-1 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
AT_hook 206 218 3.94e-1 SMART
low complexity region 251 262 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 360 396 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186954
AA Change: V2768E
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877
AA Change: V2768E

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187040
AA Change: V2925E
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877
AA Change: V2925E

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189629
AA Change: V2749E
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023
AA Change: V2749E

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190278
SMART Domains Protein: ENSMUSP00000144111
Gene: ENSMUSG00000106715

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190390
AA Change: V2864E
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877
AA Change: V2864E

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably benign
Transcript: ENSMUST00000206825
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,261 probably benign Het
4932438A13Rik T C 3: 36,998,331 M3060T probably benign Het
Aak1 T A 6: 86,967,355 S749T unknown Het
Abcb4 A T 5: 8,940,968 I843F probably damaging Het
Abcb6 A T 1: 75,172,679 probably benign Het
AC161516.2 G T 5: 67,946,397 probably benign Het
AC238840.1 A T 7: 38,767,953 noncoding transcript Het
Actr8 T A 14: 29,986,969 H244Q possibly damaging Het
Acyp2 A G 11: 30,506,452 probably benign Het
Adgrv1 A G 13: 81,382,298 Y5886H probably benign Het
Afap1 C T 5: 35,961,737 probably benign Het
Agk T A 6: 40,386,817 W244R probably damaging Het
Akirin1 T A 4: 123,738,090 probably benign Het
Ankrd11 C A 8: 122,899,724 V161L probably damaging Het
Arap3 T C 18: 37,989,196 probably null Het
Arhgap29 A G 3: 121,992,319 probably benign Het
Armc3 A G 2: 19,238,736 M88V probably benign Het
Atp13a5 G T 16: 29,349,015 P109T probably benign Het
Avpr1b T A 1: 131,600,585 V282D probably damaging Het
Baz2b T C 2: 59,978,546 K120E possibly damaging Het
Cacna1a T A 8: 84,514,950 probably benign Het
Cacng6 G A 7: 3,424,888 C76Y probably damaging Het
Cactin G T 10: 81,323,151 E279* probably null Het
Car9 A G 4: 43,510,222 Y268C probably damaging Het
Ccdc146 T A 5: 21,319,566 I263F probably damaging Het
Cdc16 A T 8: 13,758,992 probably benign Het
Cdh16 T G 8: 104,618,371 S429R probably benign Het
Cep250 A G 2: 155,991,075 E1639G probably damaging Het
Ces1d A T 8: 93,195,021 V38D possibly damaging Het
Chd1 A T 17: 15,726,283 Q97L possibly damaging Het
Ciita G A 16: 10,514,468 D898N possibly damaging Het
Clstn1 A G 4: 149,634,722 N336S possibly damaging Het
Cntnap5a A G 1: 116,259,519 D607G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col20a1 C T 2: 180,994,960 H245Y probably benign Het
Coq8b A T 7: 27,252,309 T399S probably benign Het
Cpn2 A G 16: 30,260,185 S233P probably benign Het
Cryz G A 3: 154,606,476 G70D probably damaging Het
Csmd1 G T 8: 16,157,204 probably benign Het
Def6 T A 17: 28,225,982 D451E possibly damaging Het
Dnah8 T A 17: 30,747,277 C2480* probably null Het
Dnah9 T C 11: 65,927,822 N3230S probably benign Het
Dyrk4 G T 6: 126,916,374 S15* probably null Het
Erc1 T C 6: 119,694,602 R917G probably damaging Het
Fgd2 T A 17: 29,374,108 probably benign Het
Frem3 G T 8: 80,611,191 V38L probably benign Het
Gas2l3 T C 10: 89,413,934 I441V probably benign Het
Gm14393 T A 2: 175,063,981 Y6F probably damaging Het
Gm1527 A G 3: 28,915,268 K256E possibly damaging Het
Gtf2ird1 T A 5: 134,395,802 probably null Het
Hmces C A 6: 87,936,139 T292K probably benign Het
Hpse2 G A 19: 43,388,253 S20L probably benign Het
Ikbke A T 1: 131,276,487 V23E probably null Het
Ino80 A T 2: 119,379,649 V1387E probably damaging Het
Islr G T 9: 58,157,306 A306D probably damaging Het
Jakmip1 G A 5: 37,100,838 G276D probably damaging Het
Jchain A G 5: 88,526,120 V55A probably benign Het
Kalrn T C 16: 34,187,471 K1350E probably damaging Het
Kansl1l T C 1: 66,801,997 Q48R possibly damaging Het
Kmt5a T C 5: 124,447,271 L23P probably damaging Het
Lrba C T 3: 86,737,142 H381Y probably damaging Het
Lrch3 T C 16: 32,988,495 probably benign Het
Lrrc32 T C 7: 98,499,357 V448A probably benign Het
Mapkbp1 T C 2: 120,017,820 M617T probably damaging Het
Megf6 C T 4: 154,252,419 probably benign Het
Mfap1a T C 2: 121,502,801 M50V probably benign Het
Mgam G T 6: 40,759,128 A854S probably damaging Het
Myh3 A C 11: 67,098,059 probably benign Het
Myo18b C A 5: 112,693,033 R2298L probably damaging Het
Myo1h T A 5: 114,319,704 M92K probably damaging Het
Nfkbib T C 7: 28,762,022 probably null Het
Nlrp2 T A 7: 5,300,951 T192S probably benign Het
Nr2f1 A T 13: 78,198,165 Y137N possibly damaging Het
Nup98 T A 7: 102,147,306 D841V probably damaging Het
Nvl A G 1: 181,139,262 V59A probably damaging Het
Ogdhl C A 14: 32,346,788 N948K probably damaging Het
Olfr530 A G 7: 140,373,113 S166P probably benign Het
Olfr538 A G 7: 140,574,749 T199A probably benign Het
Olfr578 A C 7: 102,984,323 Y280* probably null Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Orc2 A C 1: 58,481,158 probably benign Het
Osgin1 G A 8: 119,444,965 R166H probably damaging Het
Palb2 A T 7: 122,107,523 F741I probably benign Het
Palb2 G T 7: 122,107,524 Y740* probably null Het
Parvb G A 15: 84,271,252 G46D probably damaging Het
Parvb G A 15: 84,271,308 D65N probably benign Het
Pcsk2 A T 2: 143,546,518 K10* probably null Het
Pde3a C T 6: 141,466,206 A502V probably benign Het
Pfas T C 11: 68,991,359 I893V probably benign Het
Pla2g4a A T 1: 149,840,720 D663E probably damaging Het
Prickle2 G A 6: 92,458,602 P6L probably damaging Het
Prx T A 7: 27,517,601 M648K probably benign Het
Ptpn21 T C 12: 98,688,476 N744S probably benign Het
Ptprq C T 10: 107,718,574 V97M probably damaging Het
Pvr T C 7: 19,918,624 E122G possibly damaging Het
Racgap1 T C 15: 99,639,775 K15E probably damaging Het
Rock1 C T 18: 10,136,091 probably null Het
Rorc T A 3: 94,397,302 Y331* probably null Het
Rpl37 T C 15: 5,118,614 V91A probably benign Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Ryr3 T A 2: 112,653,007 M4142L probably benign Het
Sash1 A T 10: 8,789,593 L125H probably damaging Het
Scn5a T C 9: 119,536,475 M369V possibly damaging Het
Siglec1 A T 2: 131,070,387 N1678K probably benign Het
Slc15a5 A T 6: 138,072,994 V141E probably benign Het
Slc43a1 T C 2: 84,859,676 probably benign Het
Slc8a3 A T 12: 81,199,710 H856Q probably benign Het
Sptlc2 T A 12: 87,355,640 M171L probably benign Het
St6gal2 A G 17: 55,490,943 D310G probably damaging Het
Susd2 T A 10: 75,638,054 D689V probably damaging Het
Suz12 A T 11: 80,019,732 E303V possibly damaging Het
Taldo1 C A 7: 141,398,587 T150K probably damaging Het
Tex14 T C 11: 87,549,529 probably benign Het
Tg T A 15: 66,849,463 F274I possibly damaging Het
Tmem151b T C 17: 45,545,737 D259G probably damaging Het
Tmem179 G T 12: 112,501,854 H64Q probably benign Het
Tmem236 A G 2: 14,218,921 T174A probably benign Het
Tmtc1 T A 6: 148,305,985 probably benign Het
Tnc A T 4: 63,966,574 N1821K probably damaging Het
Tnfrsf11a A G 1: 105,825,048 N261S probably damaging Het
Traf6 G T 2: 101,696,649 probably benign Het
Trank1 C A 9: 111,343,232 F96L possibly damaging Het
Trim56 T A 5: 137,113,163 I500F probably damaging Het
Ttc30b G T 2: 75,937,811 S199R probably benign Het
Ttll5 A G 12: 85,879,394 I321V possibly damaging Het
Ttn C A 2: 76,778,023 W17852L probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Uba52 A G 8: 70,509,556 I127T possibly damaging Het
Ubr4 T A 4: 139,421,226 probably null Het
Uggt1 A T 1: 36,176,796 M130K probably benign Het
Ulk4 T A 9: 121,081,656 T1101S probably benign Het
Urb1 A G 16: 90,752,014 S2269P probably benign Het
Ush2a G T 1: 188,400,206 R875L probably benign Het
Usp9y T A Y: 1,332,471 H1624L probably benign Homo
Vipr1 T C 9: 121,665,520 L308S possibly damaging Het
Vps50 G A 6: 3,517,777 probably benign Het
Xdh T G 17: 73,891,112 K1260T probably damaging Het
Yipf4 A G 17: 74,493,968 I94V probably benign Het
Zfhx4 A G 3: 5,413,146 *3582W probably null Het
Zfp58 T C 13: 67,492,025 N116D possibly damaging Het
Zfp750 C A 11: 121,511,993 R643L probably benign Het
Znfx1 A G 2: 167,042,587 V51A possibly damaging Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127542713 splice site probably benign
IGL00475:Srcap APN 7 127552921 missense possibly damaging 0.92
IGL01064:Srcap APN 7 127559892 unclassified probably benign
IGL01129:Srcap APN 7 127521651 missense probably damaging 1.00
IGL01670:Srcap APN 7 127528432 missense probably damaging 1.00
IGL01861:Srcap APN 7 127525285 splice site probably benign
IGL02237:Srcap APN 7 127534692 splice site probably benign
IGL02665:Srcap APN 7 127540903 missense probably damaging 1.00
IGL02688:Srcap APN 7 127542453 missense probably benign 0.04
IGL02744:Srcap APN 7 127534666 missense probably damaging 1.00
IGL02810:Srcap APN 7 127521663 critical splice donor site probably null
IGL03184:Srcap APN 7 127530502 unclassified probably benign
IGL03309:Srcap APN 7 127530793 missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127549320 missense possibly damaging 0.52
R1340:Srcap UTSW 7 127560738 intron probably benign
R1401:Srcap UTSW 7 127559952 unclassified probably benign
R1455:Srcap UTSW 7 127530650 missense probably damaging 0.99
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1761:Srcap UTSW 7 127534845 missense probably damaging 1.00
R1911:Srcap UTSW 7 127534822 missense probably damaging 0.99
R2483:Srcap UTSW 7 127542147 missense probably damaging 0.99
R2892:Srcap UTSW 7 127539065 missense probably damaging 0.99
R2893:Srcap UTSW 7 127539065 missense probably damaging 0.99
R3623:Srcap UTSW 7 127542147 missense probably damaging 0.99
R3976:Srcap UTSW 7 127549239 missense probably benign 0.18
R4001:Srcap UTSW 7 127532167 missense probably damaging 1.00
R4015:Srcap UTSW 7 127525423 missense probably benign 0.27
R4581:Srcap UTSW 7 127558310 unclassified probably benign
R4643:Srcap UTSW 7 127541776 missense probably damaging 1.00
R4644:Srcap UTSW 7 127552598 missense probably damaging 1.00
R4690:Srcap UTSW 7 127538014 missense probably damaging 1.00
R4693:Srcap UTSW 7 127538544 missense probably damaging 1.00
R4719:Srcap UTSW 7 127541559 missense probably benign 0.13
R4728:Srcap UTSW 7 127540924 critical splice donor site probably null
R4740:Srcap UTSW 7 127549299 missense probably damaging 1.00
R4752:Srcap UTSW 7 127559000 unclassified probably benign
R4834:Srcap UTSW 7 127557610 critical splice donor site probably null
R4837:Srcap UTSW 7 127558962 unclassified probably benign
R4884:Srcap UTSW 7 127522017 missense probably damaging 1.00
R4889:Srcap UTSW 7 127538547 missense possibly damaging 0.94
R5088:Srcap UTSW 7 127541661 missense probably benign 0.02
R5102:Srcap UTSW 7 127530623 missense probably damaging 1.00
R5358:Srcap UTSW 7 127540320 missense probably damaging 1.00
R5372:Srcap UTSW 7 127557613 splice site probably null
R5397:Srcap UTSW 7 127553296 critical splice donor site probably null
R5481:Srcap UTSW 7 127532197 missense probably damaging 1.00
R5566:Srcap UTSW 7 127525303 missense probably damaging 0.99
R5584:Srcap UTSW 7 127528479 missense probably damaging 1.00
R5693:Srcap UTSW 7 127519816 missense probably damaging 1.00
R5769:Srcap UTSW 7 127559822 unclassified probably benign
R5805:Srcap UTSW 7 127542039 missense possibly damaging 0.87
R5806:Srcap UTSW 7 127559163 unclassified probably benign
R5921:Srcap UTSW 7 127558833 unclassified probably benign
R5942:Srcap UTSW 7 127538008 missense probably damaging 1.00
R6014:Srcap UTSW 7 127538750 missense probably benign 0.01
R6057:Srcap UTSW 7 127541356 missense probably damaging 0.99
R6113:Srcap UTSW 7 127560281 unclassified probably benign
R6150:Srcap UTSW 7 127534828 missense probably damaging 1.00
R6212:Srcap UTSW 7 127549689 missense probably damaging 1.00
R6299:Srcap UTSW 7 127530454 unclassified probably benign
R6437:Srcap UTSW 7 127528550 intron probably null
R6492:Srcap UTSW 7 127522145 nonsense probably null
R6537:Srcap UTSW 7 127542220 missense probably damaging 0.97
R6659:Srcap UTSW 7 127542391 missense probably damaging 1.00
R6713:Srcap UTSW 7 127534917 missense probably benign 0.28
R6717:Srcap UTSW 7 127558310 unclassified probably benign
R6941:Srcap UTSW 7 127542597 missense probably damaging 1.00
R7068:Srcap UTSW 7 127541943 missense probably benign 0.00
R7097:Srcap UTSW 7 127539041 missense probably damaging 1.00
R7394:Srcap UTSW 7 127534828 missense probably damaging 1.00
R7426:Srcap UTSW 7 127538517 missense possibly damaging 0.90
R7434:Srcap UTSW 7 127560242 missense unknown
R7559:Srcap UTSW 7 127530550 missense unknown
R7638:Srcap UTSW 7 127538748 missense probably benign 0.39
R7677:Srcap UTSW 7 127559808 missense unknown
R7715:Srcap UTSW 7 127549288 missense probably damaging 0.99
X0025:Srcap UTSW 7 127560105 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATCGATCCACAGTATGTCAG -3'
(R):5'- CCGTCTTTTCTCCACAGGCGATAG -3'

Sequencing Primer
(F):5'- TATGTCAGGGCCAGAATCCTC -3'
(R):5'- CTCCACAGGCGATAGGATGG -3'
Posted On2014-05-23