Incidental Mutation 'R0084:Ndufb5'
ID19799
Institutional Source Beutler Lab
Gene Symbol Ndufb5
Ensembl Gene ENSMUSG00000027673
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Synonyms0610007D05Rik
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32736990-32751566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32737203 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 33 (V33A)
Ref Sequence ENSEMBL: ENSMUSP00000029217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029217] [ENSMUST00000043966] [ENSMUST00000121778] [ENSMUST00000127477] [ENSMUST00000139593] [ENSMUST00000154257]
Predicted Effect probably benign
Transcript: ENSMUST00000029217
AA Change: V33A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000043966
SMART Domains Protein: ENSMUSP00000048078
Gene: ENSMUSG00000037531

DomainStartEndE-ValueType
Pfam:MRP-L47 66 151 4.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121778
AA Change: V41A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113169
Gene: ENSMUSG00000027673
AA Change: V41A

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 163 5.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127477
AA Change: V41A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114963
Gene: ENSMUSG00000027673
AA Change: V41A

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 189 3.5e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139593
SMART Domains Protein: ENSMUSP00000115088
Gene: ENSMUSG00000027673

DomainStartEndE-ValueType
Pfam:NDUF_B5 6 172 6e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153564
Predicted Effect probably benign
Transcript: ENSMUST00000154257
AA Change: V26A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117240
Gene: ENSMUSG00000027673
AA Change: V26A

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 135 8.4e-69 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156174
AA Change: V32A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195565
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Ndufb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ndufb5 APN 3 32744899 missense probably damaging 0.98
IGL01688:Ndufb5 APN 3 32746464 nonsense probably null
IGL02629:Ndufb5 APN 3 32737199 missense probably benign 0.02
R2851:Ndufb5 UTSW 3 32746451 missense probably damaging 1.00
R5663:Ndufb5 UTSW 3 32747749 missense possibly damaging 0.90
R5742:Ndufb5 UTSW 3 32747781 missense probably damaging 0.99
R6609:Ndufb5 UTSW 3 32741683 missense probably benign 0.01
Z31818:Ndufb5 UTSW 3 32746461 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGCCCTTACTAAACATGGCCGCTC -3'
(R):5'- ACCCTGTCTCAACAACGAAGTGTG -3'

Sequencing Primer
(F):5'- CCAAGTCTGCCATAGAGTTTACAG -3'
(R):5'- CTCAACAACGAAGTGTGTGCAG -3'
Posted On2013-04-11