Incidental Mutation 'R1470:Slc8a3'
ID 197992
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms Ncx3
MMRRC Submission 039523-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1470 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 81244689-81379954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81246484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 856 (H856Q)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]
AlphaFold S4R2P9
Predicted Effect probably benign
Transcript: ENSMUST00000064594
AA Change: H855Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: H855Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085238
AA Change: H849Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: H849Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182208
AA Change: H856Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: H856Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182366
SMART Domains Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
PDB:2LT9|A 1 52 2e-28 PDB
low complexity region 82 93 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,337 (GRCm39) S749T unknown Het
Abcb4 A T 5: 8,990,968 (GRCm39) I843F probably damaging Het
Abcb6 A T 1: 75,149,323 (GRCm39) probably benign Het
AC238840.1 A T 7: 38,467,377 (GRCm39) noncoding transcript Het
Actr8 T A 14: 29,708,926 (GRCm39) H244Q possibly damaging Het
Acyp2 A G 11: 30,456,452 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,530,417 (GRCm39) Y5886H probably benign Het
Afap1 C T 5: 36,119,081 (GRCm39) probably benign Het
Agk T A 6: 40,363,751 (GRCm39) W244R probably damaging Het
Akirin1 T A 4: 123,631,883 (GRCm39) probably benign Het
Ankrd11 C A 8: 123,626,463 (GRCm39) V161L probably damaging Het
Arap3 T C 18: 38,122,249 (GRCm39) probably null Het
Arhgap29 A G 3: 121,785,968 (GRCm39) probably benign Het
Armc3 A G 2: 19,243,547 (GRCm39) M88V probably benign Het
Atp13a5 G T 16: 29,167,833 (GRCm39) P109T probably benign Het
Avpr1b T A 1: 131,528,323 (GRCm39) V282D probably damaging Het
Baz2b T C 2: 59,808,890 (GRCm39) K120E possibly damaging Het
Bltp1 T C 3: 37,052,480 (GRCm39) M3060T probably benign Het
Cacna1a T A 8: 85,241,579 (GRCm39) probably benign Het
Cacng6 G A 7: 3,473,404 (GRCm39) C76Y probably damaging Het
Cactin G T 10: 81,158,985 (GRCm39) E279* probably null Het
Car9 A G 4: 43,510,222 (GRCm39) Y268C probably damaging Het
Ccdc146 T A 5: 21,524,564 (GRCm39) I263F probably damaging Het
Cdc16 A T 8: 13,808,992 (GRCm39) probably benign Het
Cdh16 T G 8: 105,345,003 (GRCm39) S429R probably benign Het
Cep250 A G 2: 155,832,995 (GRCm39) E1639G probably damaging Het
Ces1d A T 8: 93,921,649 (GRCm39) V38D possibly damaging Het
Chd1 A T 17: 15,946,545 (GRCm39) Q97L possibly damaging Het
Ciita G A 16: 10,332,332 (GRCm39) D898N possibly damaging Het
Clstn1 A G 4: 149,719,179 (GRCm39) N336S possibly damaging Het
Cntnap5a A G 1: 116,187,249 (GRCm39) D607G probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col20a1 C T 2: 180,636,753 (GRCm39) H245Y probably benign Het
Coq8b A T 7: 26,951,734 (GRCm39) T399S probably benign Het
Cpn2 A G 16: 30,079,003 (GRCm39) S233P probably benign Het
Cryz G A 3: 154,312,113 (GRCm39) G70D probably damaging Het
Csmd1 G T 8: 16,207,218 (GRCm39) probably benign Het
Def6 T A 17: 28,444,956 (GRCm39) D451E possibly damaging Het
Dnah8 T A 17: 30,966,251 (GRCm39) C2480* probably null Het
Dnah9 T C 11: 65,818,648 (GRCm39) N3230S probably benign Het
Dyrk4 G T 6: 126,893,337 (GRCm39) S15* probably null Het
Erc1 T C 6: 119,671,563 (GRCm39) R917G probably damaging Het
Fgd2 T A 17: 29,593,082 (GRCm39) probably benign Het
Frem3 G T 8: 81,337,820 (GRCm39) V38L probably benign Het
Gas2l3 T C 10: 89,249,796 (GRCm39) I441V probably benign Het
Gm14393 T A 2: 174,905,774 (GRCm39) Y6F probably damaging Het
Gm1527 A G 3: 28,969,417 (GRCm39) K256E possibly damaging Het
Gm21905 G T 5: 68,103,740 (GRCm39) probably benign Het
Gtf2ird1 T A 5: 134,424,656 (GRCm39) probably null Het
Hmces C A 6: 87,913,121 (GRCm39) T292K probably benign Het
Hpse2 G A 19: 43,376,692 (GRCm39) S20L probably benign Het
Ift70b G T 2: 75,768,155 (GRCm39) S199R probably benign Het
Ikbke A T 1: 131,204,224 (GRCm39) V23E probably null Het
Ino80 A T 2: 119,210,130 (GRCm39) V1387E probably damaging Het
Islr G T 9: 58,064,589 (GRCm39) A306D probably damaging Het
Jakmip1 G A 5: 37,258,182 (GRCm39) G276D probably damaging Het
Jchain A G 5: 88,673,979 (GRCm39) V55A probably benign Het
Kalrn T C 16: 34,007,841 (GRCm39) K1350E probably damaging Het
Kansl1l T C 1: 66,841,156 (GRCm39) Q48R possibly damaging Het
Kmt5a T C 5: 124,585,334 (GRCm39) L23P probably damaging Het
Lrba C T 3: 86,644,449 (GRCm39) H381Y probably damaging Het
Lrch3 T C 16: 32,808,865 (GRCm39) probably benign Het
Lrrc32 T C 7: 98,148,564 (GRCm39) V448A probably benign Het
Mapkbp1 T C 2: 119,848,301 (GRCm39) M617T probably damaging Het
Megf6 C T 4: 154,336,876 (GRCm39) probably benign Het
Mfap1a T C 2: 121,333,282 (GRCm39) M50V probably benign Het
Mgam G T 6: 40,736,062 (GRCm39) A854S probably damaging Het
Myh3 A C 11: 66,988,885 (GRCm39) probably benign Het
Myo18b C A 5: 112,840,899 (GRCm39) R2298L probably damaging Het
Myo1h T A 5: 114,457,765 (GRCm39) M92K probably damaging Het
Nfkbib T C 7: 28,461,447 (GRCm39) probably null Het
Nlrp2 T A 7: 5,303,950 (GRCm39) T192S probably benign Het
Nr2f1 A T 13: 78,346,284 (GRCm39) Y137N possibly damaging Het
Nup98 T A 7: 101,796,513 (GRCm39) D841V probably damaging Het
Nvl A G 1: 180,966,827 (GRCm39) V59A probably damaging Het
Ogdhl C A 14: 32,068,745 (GRCm39) N948K probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or12j3 A G 7: 139,953,026 (GRCm39) S166P probably benign Het
Or13a24 A G 7: 140,154,662 (GRCm39) T199A probably benign Het
Or51g1 A C 7: 102,633,530 (GRCm39) Y280* probably null Het
Orc2 A C 1: 58,520,317 (GRCm39) probably benign Het
Osgin1 G A 8: 120,171,704 (GRCm39) R166H probably damaging Het
Palb2 A T 7: 121,706,746 (GRCm39) F741I probably benign Het
Palb2 G T 7: 121,706,747 (GRCm39) Y740* probably null Het
Parvb G A 15: 84,155,453 (GRCm39) G46D probably damaging Het
Parvb G A 15: 84,155,509 (GRCm39) D65N probably benign Het
Pcsk2 A T 2: 143,388,438 (GRCm39) K10* probably null Het
Pde3a C T 6: 141,411,932 (GRCm39) A502V probably benign Het
Pfas T C 11: 68,882,185 (GRCm39) I893V probably benign Het
Pla2g4a A T 1: 149,716,471 (GRCm39) D663E probably damaging Het
Prickle2 G A 6: 92,435,583 (GRCm39) P6L probably damaging Het
Prx T A 7: 27,217,026 (GRCm39) M648K probably benign Het
Ptpn21 T C 12: 98,654,735 (GRCm39) N744S probably benign Het
Ptprq C T 10: 107,554,435 (GRCm39) V97M probably damaging Het
Pvr T C 7: 19,652,549 (GRCm39) E122G possibly damaging Het
Racgap1 T C 15: 99,537,656 (GRCm39) K15E probably damaging Het
Rock1 C T 18: 10,136,091 (GRCm39) probably null Het
Rorc T A 3: 94,304,609 (GRCm39) Y331* probably null Het
Rpl37 T C 15: 5,148,096 (GRCm39) V91A probably benign Het
Rrp36 T A 17: 46,983,306 (GRCm39) K103* probably null Het
Ryr3 T A 2: 112,483,352 (GRCm39) M4142L probably benign Het
Sash1 A T 10: 8,665,357 (GRCm39) L125H probably damaging Het
Scn5a T C 9: 119,365,541 (GRCm39) M369V possibly damaging Het
Siglec1 A T 2: 130,912,307 (GRCm39) N1678K probably benign Het
Slc15a5 A T 6: 138,049,992 (GRCm39) V141E probably benign Het
Slc43a1 T C 2: 84,690,020 (GRCm39) probably benign Het
Spmip11 T C 15: 98,483,142 (GRCm39) probably benign Het
Sptlc2 T A 12: 87,402,414 (GRCm39) M171L probably benign Het
Srcap T A 7: 127,158,899 (GRCm39) probably benign Het
St6gal2 A G 17: 55,797,944 (GRCm39) D310G probably damaging Het
Susd2 T A 10: 75,473,888 (GRCm39) D689V probably damaging Het
Suz12 A T 11: 79,910,558 (GRCm39) E303V possibly damaging Het
Taldo1 C A 7: 140,978,500 (GRCm39) T150K probably damaging Het
Tex14 T C 11: 87,440,355 (GRCm39) probably benign Het
Tg T A 15: 66,721,312 (GRCm39) F274I possibly damaging Het
Tmem151b T C 17: 45,856,663 (GRCm39) D259G probably damaging Het
Tmem179 G T 12: 112,468,288 (GRCm39) H64Q probably benign Het
Tmem236 A G 2: 14,223,732 (GRCm39) T174A probably benign Het
Tmtc1 T A 6: 148,207,483 (GRCm39) probably benign Het
Tnc A T 4: 63,884,811 (GRCm39) N1821K probably damaging Het
Tnfrsf11a A G 1: 105,752,773 (GRCm39) N261S probably damaging Het
Traf6 G T 2: 101,526,994 (GRCm39) probably benign Het
Trank1 C A 9: 111,172,300 (GRCm39) F96L possibly damaging Het
Trim56 T A 5: 137,142,017 (GRCm39) I500F probably damaging Het
Ttll5 A G 12: 85,926,168 (GRCm39) I321V possibly damaging Het
Ttn C A 2: 76,608,367 (GRCm39) W17852L probably damaging Het
Twnk G A 19: 44,997,820 (GRCm39) V450M probably damaging Het
Uba52 A G 8: 70,962,206 (GRCm39) I127T possibly damaging Het
Ubr4 T A 4: 139,148,537 (GRCm39) probably null Het
Uggt1 A T 1: 36,215,877 (GRCm39) M130K probably benign Het
Ulk4 T A 9: 120,910,722 (GRCm39) T1101S probably benign Het
Urb1 A G 16: 90,548,902 (GRCm39) S2269P probably benign Het
Ush2a G T 1: 188,132,403 (GRCm39) R875L probably benign Het
Usp9y T A Y: 1,332,471 (GRCm39) H1624L probably benign Homo
Vipr1 T C 9: 121,494,586 (GRCm39) L308S possibly damaging Het
Vps50 G A 6: 3,517,777 (GRCm39) probably benign Het
Xdh T G 17: 74,198,107 (GRCm39) K1260T probably damaging Het
Yipf4 A G 17: 74,800,963 (GRCm39) I94V probably benign Het
Zfhx4 A G 3: 5,478,206 (GRCm39) *3582W probably null Het
Zfp58 T C 13: 67,640,144 (GRCm39) N116D possibly damaging Het
Zfp750 C A 11: 121,402,819 (GRCm39) R643L probably benign Het
Znfx1 A G 2: 166,884,507 (GRCm39) V51A possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81,361,343 (GRCm39) missense probably benign
IGL01315:Slc8a3 APN 12 81,361,169 (GRCm39) missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81,362,150 (GRCm39) missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81,362,576 (GRCm39) missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81,362,457 (GRCm39) missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81,361,998 (GRCm39) missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81,250,930 (GRCm39) splice site probably benign
IGL02646:Slc8a3 APN 12 81,361,868 (GRCm39) missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81,249,023 (GRCm39) missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81,362,039 (GRCm39) missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81,361,616 (GRCm39) missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81,362,790 (GRCm39) missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1557:Slc8a3 UTSW 12 81,362,331 (GRCm39) missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81,251,781 (GRCm39) missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81,361,618 (GRCm39) missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81,361,994 (GRCm39) missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81,249,113 (GRCm39) missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81,361,953 (GRCm39) missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81,250,912 (GRCm39) missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81,361,646 (GRCm39) missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81,361,950 (GRCm39) missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81,362,627 (GRCm39) missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81,361,625 (GRCm39) missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R4951:Slc8a3 UTSW 12 81,361,473 (GRCm39) missense probably benign 0.31
R5022:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81,260,906 (GRCm39) missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81,260,908 (GRCm39) missense probably null 0.34
R5122:Slc8a3 UTSW 12 81,361,032 (GRCm39) critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81,361,265 (GRCm39) missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81,246,405 (GRCm39) missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81,361,124 (GRCm39) missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81,246,341 (GRCm39) missense probably benign
R6279:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81,362,401 (GRCm39) missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81,361,206 (GRCm39) missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81,361,529 (GRCm39) missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81,361,047 (GRCm39) missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81,361,827 (GRCm39) missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81,263,598 (GRCm39) missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81,362,579 (GRCm39) missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81,361,577 (GRCm39) missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81,260,832 (GRCm39) splice site probably null
R7549:Slc8a3 UTSW 12 81,361,544 (GRCm39) missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81,361,158 (GRCm39) missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81,361,247 (GRCm39) missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81,361,325 (GRCm39) missense probably benign
R7960:Slc8a3 UTSW 12 81,263,506 (GRCm39) missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81,361,767 (GRCm39) missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81,249,032 (GRCm39) missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81,246,455 (GRCm39) missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81,246,542 (GRCm39) missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81,361,452 (GRCm39) missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81,361,914 (GRCm39) missense probably benign
R9060:Slc8a3 UTSW 12 81,260,852 (GRCm39) missense probably benign 0.45
R9061:Slc8a3 UTSW 12 81,263,540 (GRCm39) missense probably damaging 0.99
R9267:Slc8a3 UTSW 12 81,361,208 (GRCm39) missense possibly damaging 0.77
R9416:Slc8a3 UTSW 12 81,361,838 (GRCm39) missense probably benign 0.06
R9519:Slc8a3 UTSW 12 81,362,326 (GRCm39) missense probably benign 0.30
R9531:Slc8a3 UTSW 12 81,361,997 (GRCm39) missense probably damaging 1.00
X0026:Slc8a3 UTSW 12 81,362,061 (GRCm39) missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81,361,717 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81,362,650 (GRCm39) missense probably benign 0.13
Z1177:Slc8a3 UTSW 12 81,361,474 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGCTCACAAAGAGCCATGTCG -3'
(R):5'- TTGGATGCACTCAAGGCCACAC -3'

Sequencing Primer
(F):5'- CACTGAGGCAGACAAATGCA -3'
(R):5'- ctcaaggccacacagctc -3'
Posted On 2014-05-23