Mutagenetix > Incidental Mutation

Incidental Mutation 'R1470:Tg'

198004

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

039523-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R1470 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66849463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 274 (F274I)

Ref Sequence

ENSEMBL: ENSMUSP00000155392 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000166403] [ENSMUST00000171045]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065916
AA Change: F2673I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: F2673I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163495

SMART Domains

Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
TY	14	63	1.21e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166403
AA Change: F274I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171045
AA Change: F1054I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: F1054I

Domain	Start	End	E-Value	Type
internal_repeat_1	93	331	1.53e-6	PROSPERO
Pfam:COesterase	562	1098	2.1e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172153

SMART Domains

Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
Pfam:COesterase	313	849	6e-140	PFAM

Meta Mutation Damage Score

0.1234

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.0%

Validation Efficiency

97% (125/129)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 142 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	T	C	15: 98,585,261		probably benign	Het
4932438A13Rik	T	C	3: 36,998,331	M3060T	probably benign	Het
Aak1	T	A	6: 86,967,355	S749T	unknown	Het
Abcb4	A	T	5: 8,940,968	I843F	probably damaging	Het
Abcb6	A	T	1: 75,172,679		probably benign	Het
AC161516.2	G	T	5: 67,946,397		probably benign	Het
AC238840.1	A	T	7: 38,767,953		noncoding transcript	Het
Actr8	T	A	14: 29,986,969	H244Q	possibly damaging	Het
Acyp2	A	G	11: 30,506,452		probably benign	Het
Adgrv1	A	G	13: 81,382,298	Y5886H	probably benign	Het
Afap1	C	T	5: 35,961,737		probably benign	Het
Agk	T	A	6: 40,386,817	W244R	probably damaging	Het
Akirin1	T	A	4: 123,738,090		probably benign	Het
Ankrd11	C	A	8: 122,899,724	V161L	probably damaging	Het
Arap3	T	C	18: 37,989,196		probably null	Het
Arhgap29	A	G	3: 121,992,319		probably benign	Het
Armc3	A	G	2: 19,238,736	M88V	probably benign	Het
Atp13a5	G	T	16: 29,349,015	P109T	probably benign	Het
Avpr1b	T	A	1: 131,600,585	V282D	probably damaging	Het
Baz2b	T	C	2: 59,978,546	K120E	possibly damaging	Het
Cacna1a	T	A	8: 84,514,950		probably benign	Het
Cacng6	G	A	7: 3,424,888	C76Y	probably damaging	Het
Cactin	G	T	10: 81,323,151	E279*	probably null	Het
Car9	A	G	4: 43,510,222	Y268C	probably damaging	Het
Ccdc146	T	A	5: 21,319,566	I263F	probably damaging	Het
Cdc16	A	T	8: 13,758,992		probably benign	Het
Cdh16	T	G	8: 104,618,371	S429R	probably benign	Het
Cep250	A	G	2: 155,991,075	E1639G	probably damaging	Het
Ces1d	A	T	8: 93,195,021	V38D	possibly damaging	Het
Chd1	A	T	17: 15,726,283	Q97L	possibly damaging	Het
Ciita	G	A	16: 10,514,468	D898N	possibly damaging	Het
Clstn1	A	G	4: 149,634,722	N336S	possibly damaging	Het
Cntnap5a	A	G	1: 116,259,519	D607G	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col20a1	C	T	2: 180,994,960	H245Y	probably benign	Het
Coq8b	A	T	7: 27,252,309	T399S	probably benign	Het
Cpn2	A	G	16: 30,260,185	S233P	probably benign	Het
Cryz	G	A	3: 154,606,476	G70D	probably damaging	Het
Csmd1	G	T	8: 16,157,204		probably benign	Het
Def6	T	A	17: 28,225,982	D451E	possibly damaging	Het
Dnah8	T	A	17: 30,747,277	C2480*	probably null	Het
Dnah9	T	C	11: 65,927,822	N3230S	probably benign	Het
Dyrk4	G	T	6: 126,916,374	S15*	probably null	Het
Erc1	T	C	6: 119,694,602	R917G	probably damaging	Het
Fgd2	T	A	17: 29,374,108		probably benign	Het
Frem3	G	T	8: 80,611,191	V38L	probably benign	Het
Gas2l3	T	C	10: 89,413,934	I441V	probably benign	Het
Gm14393	T	A	2: 175,063,981	Y6F	probably damaging	Het
Gm1527	A	G	3: 28,915,268	K256E	possibly damaging	Het
Gtf2ird1	T	A	5: 134,395,802		probably null	Het
Hmces	C	A	6: 87,936,139	T292K	probably benign	Het
Hpse2	G	A	19: 43,388,253	S20L	probably benign	Het
Ikbke	A	T	1: 131,276,487	V23E	probably null	Het
Ino80	A	T	2: 119,379,649	V1387E	probably damaging	Het
Islr	G	T	9: 58,157,306	A306D	probably damaging	Het
Jakmip1	G	A	5: 37,100,838	G276D	probably damaging	Het
Jchain	A	G	5: 88,526,120	V55A	probably benign	Het
Kalrn	T	C	16: 34,187,471	K1350E	probably damaging	Het
Kansl1l	T	C	1: 66,801,997	Q48R	possibly damaging	Het
Kmt5a	T	C	5: 124,447,271	L23P	probably damaging	Het
Lrba	C	T	3: 86,737,142	H381Y	probably damaging	Het
Lrch3	T	C	16: 32,988,495		probably benign	Het
Lrrc32	T	C	7: 98,499,357	V448A	probably benign	Het
Mapkbp1	T	C	2: 120,017,820	M617T	probably damaging	Het
Megf6	C	T	4: 154,252,419		probably benign	Het
Mfap1a	T	C	2: 121,502,801	M50V	probably benign	Het
Mgam	G	T	6: 40,759,128	A854S	probably damaging	Het
Myh3	A	C	11: 67,098,059		probably benign	Het
Myo18b	C	A	5: 112,693,033	R2298L	probably damaging	Het
Myo1h	T	A	5: 114,319,704	M92K	probably damaging	Het
Nfkbib	T	C	7: 28,762,022		probably null	Het
Nlrp2	T	A	7: 5,300,951	T192S	probably benign	Het
Nr2f1	A	T	13: 78,198,165	Y137N	possibly damaging	Het
Nup98	T	A	7: 102,147,306	D841V	probably damaging	Het
Nvl	A	G	1: 181,139,262	V59A	probably damaging	Het
Ogdhl	C	A	14: 32,346,788	N948K	probably damaging	Het
Olfr530	A	G	7: 140,373,113	S166P	probably benign	Het
Olfr538	A	G	7: 140,574,749	T199A	probably benign	Het
Olfr578	A	C	7: 102,984,323	Y280*	probably null	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Orc2	A	C	1: 58,481,158		probably benign	Het
Osgin1	G	A	8: 119,444,965	R166H	probably damaging	Het
Palb2	A	T	7: 122,107,523	F741I	probably benign	Het
Palb2	G	T	7: 122,107,524	Y740*	probably null	Het
Parvb	G	A	15: 84,271,252	G46D	probably damaging	Het
Parvb	G	A	15: 84,271,308	D65N	probably benign	Het
Pcsk2	A	T	2: 143,546,518	K10*	probably null	Het
Pde3a	C	T	6: 141,466,206	A502V	probably benign	Het
Pfas	T	C	11: 68,991,359	I893V	probably benign	Het
Pla2g4a	A	T	1: 149,840,720	D663E	probably damaging	Het
Prickle2	G	A	6: 92,458,602	P6L	probably damaging	Het
Prx	T	A	7: 27,517,601	M648K	probably benign	Het
Ptpn21	T	C	12: 98,688,476	N744S	probably benign	Het
Ptprq	C	T	10: 107,718,574	V97M	probably damaging	Het
Pvr	T	C	7: 19,918,624	E122G	possibly damaging	Het
Racgap1	T	C	15: 99,639,775	K15E	probably damaging	Het
Rock1	C	T	18: 10,136,091		probably null	Het
Rorc	T	A	3: 94,397,302	Y331*	probably null	Het
Rpl37	T	C	15: 5,118,614	V91A	probably benign	Het
Rrp36	T	A	17: 46,672,380	K103*	probably null	Het
Ryr3	T	A	2: 112,653,007	M4142L	probably benign	Het
Sash1	A	T	10: 8,789,593	L125H	probably damaging	Het
Scn5a	T	C	9: 119,536,475	M369V	possibly damaging	Het
Siglec1	A	T	2: 131,070,387	N1678K	probably benign	Het
Slc15a5	A	T	6: 138,072,994	V141E	probably benign	Het
Slc43a1	T	C	2: 84,859,676		probably benign	Het
Slc8a3	A	T	12: 81,199,710	H856Q	probably benign	Het
Sptlc2	T	A	12: 87,355,640	M171L	probably benign	Het
Srcap	T	A	7: 127,559,727		probably benign	Het
St6gal2	A	G	17: 55,490,943	D310G	probably damaging	Het
Susd2	T	A	10: 75,638,054	D689V	probably damaging	Het
Suz12	A	T	11: 80,019,732	E303V	possibly damaging	Het
Taldo1	C	A	7: 141,398,587	T150K	probably damaging	Het
Tex14	T	C	11: 87,549,529		probably benign	Het
Tmem151b	T	C	17: 45,545,737	D259G	probably damaging	Het
Tmem179	G	T	12: 112,501,854	H64Q	probably benign	Het
Tmem236	A	G	2: 14,218,921	T174A	probably benign	Het
Tmtc1	T	A	6: 148,305,985		probably benign	Het
Tnc	A	T	4: 63,966,574	N1821K	probably damaging	Het
Tnfrsf11a	A	G	1: 105,825,048	N261S	probably damaging	Het
Traf6	G	T	2: 101,696,649		probably benign	Het
Trank1	C	A	9: 111,343,232	F96L	possibly damaging	Het
Trim56	T	A	5: 137,113,163	I500F	probably damaging	Het
Ttc30b	G	T	2: 75,937,811	S199R	probably benign	Het
Ttll5	A	G	12: 85,879,394	I321V	possibly damaging	Het
Ttn	C	A	2: 76,778,023	W17852L	probably damaging	Het
Twnk	G	A	19: 45,009,381	V450M	probably damaging	Het
Uba52	A	G	8: 70,509,556	I127T	possibly damaging	Het
Ubr4	T	A	4: 139,421,226		probably null	Het
Uggt1	A	T	1: 36,176,796	M130K	probably benign	Het
Ulk4	T	A	9: 121,081,656	T1101S	probably benign	Het
Urb1	A	G	16: 90,752,014	S2269P	probably benign	Het
Ush2a	G	T	1: 188,400,206	R875L	probably benign	Het
Usp9y	T	A	Y: 1,332,471	H1624L	probably benign	Homo
Vipr1	T	C	9: 121,665,520	L308S	possibly damaging	Het
Vps50	G	A	6: 3,517,777		probably benign	Het
Xdh	T	G	17: 73,891,112	K1260T	probably damaging	Het
Yipf4	A	G	17: 74,493,968	I94V	probably benign	Het
Zfhx4	A	G	3: 5,413,146	*3582W	probably null	Het
Zfp58	T	C	13: 67,492,025	N116D	possibly damaging	Het
Zfp750	C	A	11: 121,511,993	R643L	probably benign	Het
Znfx1	A	G	2: 167,042,587	V51A	possibly damaging	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0730:Tg	UTSW	15	66678789	missense	probably damaging	1.00
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5402:Tg	UTSW	15	66739168	missense	probably damaging	0.98
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5580:Tg	UTSW	15	66685300	missense	possibly damaging	0.66
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6505:Tg	UTSW	15	66759558	missense	probably damaging	0.99
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8304:Tg	UTSW	15	66693260	nonsense	probably null
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGATAGGGCCACGTTAGCTTCTGAG -3'
(R):5'- AGGGCACTACTACCTGCATCCTTC -3'

Sequencing Primer
(F):5'- TGTGGCCCAGTGCTTTATAATAC -3'
(R):5'- CAGAGTCTGGATGTACTTGGACC -3'

Posted On

2014-05-23