Incidental Mutation 'R1470:Xdh'
ID 198022
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 039523-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R1470 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 74198107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 1260 (K1260T)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: K1260T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: K1260T

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.9186 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (125/129)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,337 (GRCm39) S749T unknown Het
Abcb4 A T 5: 8,990,968 (GRCm39) I843F probably damaging Het
Abcb6 A T 1: 75,149,323 (GRCm39) probably benign Het
AC238840.1 A T 7: 38,467,377 (GRCm39) noncoding transcript Het
Actr8 T A 14: 29,708,926 (GRCm39) H244Q possibly damaging Het
Acyp2 A G 11: 30,456,452 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,530,417 (GRCm39) Y5886H probably benign Het
Afap1 C T 5: 36,119,081 (GRCm39) probably benign Het
Agk T A 6: 40,363,751 (GRCm39) W244R probably damaging Het
Akirin1 T A 4: 123,631,883 (GRCm39) probably benign Het
Ankrd11 C A 8: 123,626,463 (GRCm39) V161L probably damaging Het
Arap3 T C 18: 38,122,249 (GRCm39) probably null Het
Arhgap29 A G 3: 121,785,968 (GRCm39) probably benign Het
Armc3 A G 2: 19,243,547 (GRCm39) M88V probably benign Het
Atp13a5 G T 16: 29,167,833 (GRCm39) P109T probably benign Het
Avpr1b T A 1: 131,528,323 (GRCm39) V282D probably damaging Het
Baz2b T C 2: 59,808,890 (GRCm39) K120E possibly damaging Het
Bltp1 T C 3: 37,052,480 (GRCm39) M3060T probably benign Het
Cacna1a T A 8: 85,241,579 (GRCm39) probably benign Het
Cacng6 G A 7: 3,473,404 (GRCm39) C76Y probably damaging Het
Cactin G T 10: 81,158,985 (GRCm39) E279* probably null Het
Car9 A G 4: 43,510,222 (GRCm39) Y268C probably damaging Het
Ccdc146 T A 5: 21,524,564 (GRCm39) I263F probably damaging Het
Cdc16 A T 8: 13,808,992 (GRCm39) probably benign Het
Cdh16 T G 8: 105,345,003 (GRCm39) S429R probably benign Het
Cep250 A G 2: 155,832,995 (GRCm39) E1639G probably damaging Het
Ces1d A T 8: 93,921,649 (GRCm39) V38D possibly damaging Het
Chd1 A T 17: 15,946,545 (GRCm39) Q97L possibly damaging Het
Ciita G A 16: 10,332,332 (GRCm39) D898N possibly damaging Het
Clstn1 A G 4: 149,719,179 (GRCm39) N336S possibly damaging Het
Cntnap5a A G 1: 116,187,249 (GRCm39) D607G probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col20a1 C T 2: 180,636,753 (GRCm39) H245Y probably benign Het
Coq8b A T 7: 26,951,734 (GRCm39) T399S probably benign Het
Cpn2 A G 16: 30,079,003 (GRCm39) S233P probably benign Het
Cryz G A 3: 154,312,113 (GRCm39) G70D probably damaging Het
Csmd1 G T 8: 16,207,218 (GRCm39) probably benign Het
Def6 T A 17: 28,444,956 (GRCm39) D451E possibly damaging Het
Dnah8 T A 17: 30,966,251 (GRCm39) C2480* probably null Het
Dnah9 T C 11: 65,818,648 (GRCm39) N3230S probably benign Het
Dyrk4 G T 6: 126,893,337 (GRCm39) S15* probably null Het
Erc1 T C 6: 119,671,563 (GRCm39) R917G probably damaging Het
Fgd2 T A 17: 29,593,082 (GRCm39) probably benign Het
Frem3 G T 8: 81,337,820 (GRCm39) V38L probably benign Het
Gas2l3 T C 10: 89,249,796 (GRCm39) I441V probably benign Het
Gm14393 T A 2: 174,905,774 (GRCm39) Y6F probably damaging Het
Gm1527 A G 3: 28,969,417 (GRCm39) K256E possibly damaging Het
Gm21905 G T 5: 68,103,740 (GRCm39) probably benign Het
Gtf2ird1 T A 5: 134,424,656 (GRCm39) probably null Het
Hmces C A 6: 87,913,121 (GRCm39) T292K probably benign Het
Hpse2 G A 19: 43,376,692 (GRCm39) S20L probably benign Het
Ift70b G T 2: 75,768,155 (GRCm39) S199R probably benign Het
Ikbke A T 1: 131,204,224 (GRCm39) V23E probably null Het
Ino80 A T 2: 119,210,130 (GRCm39) V1387E probably damaging Het
Islr G T 9: 58,064,589 (GRCm39) A306D probably damaging Het
Jakmip1 G A 5: 37,258,182 (GRCm39) G276D probably damaging Het
Jchain A G 5: 88,673,979 (GRCm39) V55A probably benign Het
Kalrn T C 16: 34,007,841 (GRCm39) K1350E probably damaging Het
Kansl1l T C 1: 66,841,156 (GRCm39) Q48R possibly damaging Het
Kmt5a T C 5: 124,585,334 (GRCm39) L23P probably damaging Het
Lrba C T 3: 86,644,449 (GRCm39) H381Y probably damaging Het
Lrch3 T C 16: 32,808,865 (GRCm39) probably benign Het
Lrrc32 T C 7: 98,148,564 (GRCm39) V448A probably benign Het
Mapkbp1 T C 2: 119,848,301 (GRCm39) M617T probably damaging Het
Megf6 C T 4: 154,336,876 (GRCm39) probably benign Het
Mfap1a T C 2: 121,333,282 (GRCm39) M50V probably benign Het
Mgam G T 6: 40,736,062 (GRCm39) A854S probably damaging Het
Myh3 A C 11: 66,988,885 (GRCm39) probably benign Het
Myo18b C A 5: 112,840,899 (GRCm39) R2298L probably damaging Het
Myo1h T A 5: 114,457,765 (GRCm39) M92K probably damaging Het
Nfkbib T C 7: 28,461,447 (GRCm39) probably null Het
Nlrp2 T A 7: 5,303,950 (GRCm39) T192S probably benign Het
Nr2f1 A T 13: 78,346,284 (GRCm39) Y137N possibly damaging Het
Nup98 T A 7: 101,796,513 (GRCm39) D841V probably damaging Het
Nvl A G 1: 180,966,827 (GRCm39) V59A probably damaging Het
Ogdhl C A 14: 32,068,745 (GRCm39) N948K probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or12j3 A G 7: 139,953,026 (GRCm39) S166P probably benign Het
Or13a24 A G 7: 140,154,662 (GRCm39) T199A probably benign Het
Or51g1 A C 7: 102,633,530 (GRCm39) Y280* probably null Het
Orc2 A C 1: 58,520,317 (GRCm39) probably benign Het
Osgin1 G A 8: 120,171,704 (GRCm39) R166H probably damaging Het
Palb2 A T 7: 121,706,746 (GRCm39) F741I probably benign Het
Palb2 G T 7: 121,706,747 (GRCm39) Y740* probably null Het
Parvb G A 15: 84,155,453 (GRCm39) G46D probably damaging Het
Parvb G A 15: 84,155,509 (GRCm39) D65N probably benign Het
Pcsk2 A T 2: 143,388,438 (GRCm39) K10* probably null Het
Pde3a C T 6: 141,411,932 (GRCm39) A502V probably benign Het
Pfas T C 11: 68,882,185 (GRCm39) I893V probably benign Het
Pla2g4a A T 1: 149,716,471 (GRCm39) D663E probably damaging Het
Prickle2 G A 6: 92,435,583 (GRCm39) P6L probably damaging Het
Prx T A 7: 27,217,026 (GRCm39) M648K probably benign Het
Ptpn21 T C 12: 98,654,735 (GRCm39) N744S probably benign Het
Ptprq C T 10: 107,554,435 (GRCm39) V97M probably damaging Het
Pvr T C 7: 19,652,549 (GRCm39) E122G possibly damaging Het
Racgap1 T C 15: 99,537,656 (GRCm39) K15E probably damaging Het
Rock1 C T 18: 10,136,091 (GRCm39) probably null Het
Rorc T A 3: 94,304,609 (GRCm39) Y331* probably null Het
Rpl37 T C 15: 5,148,096 (GRCm39) V91A probably benign Het
Rrp36 T A 17: 46,983,306 (GRCm39) K103* probably null Het
Ryr3 T A 2: 112,483,352 (GRCm39) M4142L probably benign Het
Sash1 A T 10: 8,665,357 (GRCm39) L125H probably damaging Het
Scn5a T C 9: 119,365,541 (GRCm39) M369V possibly damaging Het
Siglec1 A T 2: 130,912,307 (GRCm39) N1678K probably benign Het
Slc15a5 A T 6: 138,049,992 (GRCm39) V141E probably benign Het
Slc43a1 T C 2: 84,690,020 (GRCm39) probably benign Het
Slc8a3 A T 12: 81,246,484 (GRCm39) H856Q probably benign Het
Spmip11 T C 15: 98,483,142 (GRCm39) probably benign Het
Sptlc2 T A 12: 87,402,414 (GRCm39) M171L probably benign Het
Srcap T A 7: 127,158,899 (GRCm39) probably benign Het
St6gal2 A G 17: 55,797,944 (GRCm39) D310G probably damaging Het
Susd2 T A 10: 75,473,888 (GRCm39) D689V probably damaging Het
Suz12 A T 11: 79,910,558 (GRCm39) E303V possibly damaging Het
Taldo1 C A 7: 140,978,500 (GRCm39) T150K probably damaging Het
Tex14 T C 11: 87,440,355 (GRCm39) probably benign Het
Tg T A 15: 66,721,312 (GRCm39) F274I possibly damaging Het
Tmem151b T C 17: 45,856,663 (GRCm39) D259G probably damaging Het
Tmem179 G T 12: 112,468,288 (GRCm39) H64Q probably benign Het
Tmem236 A G 2: 14,223,732 (GRCm39) T174A probably benign Het
Tmtc1 T A 6: 148,207,483 (GRCm39) probably benign Het
Tnc A T 4: 63,884,811 (GRCm39) N1821K probably damaging Het
Tnfrsf11a A G 1: 105,752,773 (GRCm39) N261S probably damaging Het
Traf6 G T 2: 101,526,994 (GRCm39) probably benign Het
Trank1 C A 9: 111,172,300 (GRCm39) F96L possibly damaging Het
Trim56 T A 5: 137,142,017 (GRCm39) I500F probably damaging Het
Ttll5 A G 12: 85,926,168 (GRCm39) I321V possibly damaging Het
Ttn C A 2: 76,608,367 (GRCm39) W17852L probably damaging Het
Twnk G A 19: 44,997,820 (GRCm39) V450M probably damaging Het
Uba52 A G 8: 70,962,206 (GRCm39) I127T possibly damaging Het
Ubr4 T A 4: 139,148,537 (GRCm39) probably null Het
Uggt1 A T 1: 36,215,877 (GRCm39) M130K probably benign Het
Ulk4 T A 9: 120,910,722 (GRCm39) T1101S probably benign Het
Urb1 A G 16: 90,548,902 (GRCm39) S2269P probably benign Het
Ush2a G T 1: 188,132,403 (GRCm39) R875L probably benign Het
Usp9y T A Y: 1,332,471 (GRCm39) H1624L probably benign Homo
Vipr1 T C 9: 121,494,586 (GRCm39) L308S possibly damaging Het
Vps50 G A 6: 3,517,777 (GRCm39) probably benign Het
Yipf4 A G 17: 74,800,963 (GRCm39) I94V probably benign Het
Zfhx4 A G 3: 5,478,206 (GRCm39) *3582W probably null Het
Zfp58 T C 13: 67,640,144 (GRCm39) N116D possibly damaging Het
Zfp750 C A 11: 121,402,819 (GRCm39) R643L probably benign Het
Znfx1 A G 2: 166,884,507 (GRCm39) V51A possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGATGTGTTCTCCTGAGCCCG -3'
(R):5'- ACAGAGGGATGCTCTGCTTGAGAC -3'

Sequencing Primer
(F):5'- CCTGAGCCCGATTCCTTTG -3'
(R):5'- GGTGGTAACCATGATAACCTTCTG -3'
Posted On 2014-05-23