Incidental Mutation 'R0084:Olfr517'
ID19810
Institutional Source Beutler Lab
Gene Symbol Olfr517
Ensembl Gene ENSMUSG00000066240
Gene Nameolfactory receptor 517
SynonymsGA_x6K02T2PBJ9-11199311-11198367, MOR268-4
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108867208-108872379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108868800 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000150980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084753] [ENSMUST00000216500]
Predicted Effect probably damaging
Transcript: ENSMUST00000084753
AA Change: M118K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081805
Gene: ENSMUSG00000066240
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.4e-60 PFAM
Pfam:7tm_1 41 299 4.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207346
Predicted Effect probably damaging
Transcript: ENSMUST00000216500
AA Change: M118K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.3272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Olfr517
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Olfr517 APN 7 108868275 missense possibly damaging 0.94
IGL01866:Olfr517 APN 7 108868799 missense possibly damaging 0.95
IGL02131:Olfr517 APN 7 108868208 makesense probably null
IGL02456:Olfr517 APN 7 108869050 missense probably benign 0.19
IGL02604:Olfr517 APN 7 108868650 missense probably benign 0.00
IGL02975:Olfr517 APN 7 108868855 nonsense probably null
R0504:Olfr517 UTSW 7 108868850 missense possibly damaging 0.91
R0748:Olfr517 UTSW 7 108869150 start codon destroyed probably null 1.00
R1428:Olfr517 UTSW 7 108868960 missense probably damaging 0.99
R1907:Olfr517 UTSW 7 108868498 missense possibly damaging 0.78
R2292:Olfr517 UTSW 7 108869016 missense probably benign 0.05
R3874:Olfr517 UTSW 7 108869128 missense probably damaging 0.98
R4091:Olfr517 UTSW 7 108868443 missense probably damaging 1.00
R4873:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R4875:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R5440:Olfr517 UTSW 7 108868626 missense probably damaging 1.00
R5920:Olfr517 UTSW 7 108868688 missense probably benign
R6723:Olfr517 UTSW 7 108868588 missense probably damaging 1.00
R6730:Olfr517 UTSW 7 108868573 missense probably benign 0.09
R6892:Olfr517 UTSW 7 108868515 missense probably damaging 1.00
R7473:Olfr517 UTSW 7 108868269 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTGCCTGTGAAGGCATAGATCTC -3'
(R):5'- GTGACTCTGACTGGAAATGCCCTC -3'

Sequencing Primer
(F):5'- GTCTGTACATGCAAGCTCCAG -3'
(R):5'- CTGACTGGAAATGCCCTCATTATG -3'
Posted On2013-04-11