Mutagenetix > Incidental Mutation

Incidental Mutation 'R1725:Espl1'

198109

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039757-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1725 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 102313221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 982 (V982L)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: V982L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V982L

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: V982L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	T	G	19: 58,792,762	K10T	probably benign	Het
2310079G19Rik	A	T	16: 88,627,275	F109L	probably benign	Het
Aacs	T	C	5: 125,482,935		probably null	Het
Abcc6	C	A	7: 45,992,357	D866Y	possibly damaging	Het
Acox3	T	C	5: 35,592,172	Y214H	probably benign	Het
Acss2	A	G	2: 155,556,844	T404A	possibly damaging	Het
Adgrb3	T	A	1: 25,826,300	E154V	probably damaging	Het
Akap12	G	A	10: 4,353,942	V251M	probably damaging	Het
Ambp	A	T	4: 63,144,276	M242K	possibly damaging	Het
Angptl7	T	G	4: 148,500,012	Y93S	probably damaging	Het
Apof	A	G	10: 128,269,811		probably benign	Het
Arv1	T	C	8: 124,728,452	F135L	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Cacna1s	C	T	1: 136,098,623	T1116I	probably damaging	Het
Ccdc91	A	G	6: 147,592,043	E311G	unknown	Het
Cenpf	T	C	1: 189,680,479	T196A	probably damaging	Het
Chd8	A	T	14: 52,232,573	S527T	probably benign	Het
Csmd3	A	C	15: 47,596,807	N3529K	probably damaging	Het
Csnk2a1	T	C	2: 152,257,972	V116A	probably damaging	Het
Dhx36	T	G	3: 62,506,939	M1L	probably benign	Het
Diaph3	A	G	14: 86,966,323		probably null	Het
Ephb2	G	A	4: 136,659,778	Q714*	probably null	Het
Eprs	T	A	1: 185,406,992	L858Q	probably damaging	Het
Eya2	A	G	2: 165,724,685	T219A	probably benign	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fbxl18	C	T	5: 142,886,703	R259H	probably damaging	Het
Gcc2	G	A	10: 58,304,115	R1629H	possibly damaging	Het
Gje1	G	A	10: 14,716,424	R205*	probably null	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Kmt2d	T	C	15: 98,845,234		probably benign	Het
Krt6a	A	T	15: 101,692,557	M268K	probably damaging	Het
Loxhd1	T	A	18: 77,293,241	S85T	probably benign	Het
Loxl3	G	A	6: 83,035,593	V38I	probably benign	Het
Mill2	A	G	7: 18,840,068	D26G	probably benign	Het
Muc15	T	C	2: 110,731,246	L9S	probably damaging	Het
Nat8f4	G	A	6: 85,901,098	R148*	probably null	Het
Nav3	A	T	10: 109,823,590	V722E	probably damaging	Het
Nfkb1	C	A	3: 135,667,758	G10W	probably damaging	Het
Olfr1477	T	C	19: 13,502,519	Y59H	probably damaging	Het
Olfr16	C	T	1: 172,957,341	P182L	possibly damaging	Het
Olfr31	T	G	14: 14,328,977	Y289D	probably damaging	Het
Olfr705	A	T	7: 106,714,058	F208I	probably benign	Het
Pcdhb22	T	A	18: 37,520,188	C313S	probably benign	Het
Plin4	A	G	17: 56,106,473	L384P	probably damaging	Het
Pm20d1	T	C	1: 131,816,058	I487T	probably damaging	Het
Prex1	A	T	2: 166,601,736	D334E	probably damaging	Het
Psg28	A	T	7: 18,428,011	I189N	possibly damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Rae1	A	G	2: 173,006,961	I123M	possibly damaging	Het
Sh3glb2	C	A	2: 30,350,667	E129*	probably null	Het
Simc1	T	C	13: 54,526,406	S856P	probably damaging	Het
Slc19a1	T	A	10: 77,041,838	M69K	probably benign	Het
Slc30a8	A	T	15: 52,333,604	I304F	possibly damaging	Het
Snx1	A	G	9: 66,098,329		probably null	Het
Stx18	G	A	5: 38,135,255	V234M	probably damaging	Het
Sulf2	T	C	2: 166,081,361	T615A	probably damaging	Het
Sult3a2	T	A	10: 33,779,709	K91N	probably benign	Het
Tet1	A	G	10: 62,814,477	S22P	probably damaging	Het
Tmc3	T	C	7: 83,604,732	V362A	probably damaging	Het
Trim16	A	C	11: 62,820,505	M1L	possibly damaging	Het
Trp53bp1	C	T	2: 121,252,000	V10I	possibly damaging	Het
Ttc12	T	G	9: 49,458,115	D235A	probably benign	Het
Ttn	T	C	2: 76,862,383	R452G	possibly damaging	Het
Ugt2b38	A	T	5: 87,411,871	H387Q	probably damaging	Het
Usp48	T	A	4: 137,633,422	L20*	probably null	Het
Utrn	T	C	10: 12,663,519	D1918G	probably damaging	Het
Vmn1r158	A	G	7: 22,790,647	S46P	probably benign	Het
Vmn2r97	T	A	17: 18,929,135	W262R	probably benign	Het
Vps13d	A	T	4: 145,143,260	S1917T	possibly damaging	Het
Vsx1	T	C	2: 150,686,200	N158D	probably benign	Het
Vwf	G	A	6: 125,646,282	V1781I	probably benign	Het
Wrap73	T	C	4: 154,148,752	Y128H	possibly damaging	Het
Zfp472	A	G	17: 32,977,337	K129E	possibly damaging	Het
Zscan18	A	T	7: 12,770,857	L611Q	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTCTCCATTCAGAAAGCAGCC -3'
(R):5'- TTACCAAGCCGCATGAGGACGAAC -3'

Sequencing Primer
(F):5'- AAGCAGCCACCGAGTCG -3'
(R):5'- TCAGGCATATGAGCTTCTAACC -3'

Posted On

2014-05-23