Incidental Mutation 'R0084:Zfp646'
ID19812
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0084 (G1)
Quality Score181
Status Validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127881304 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 884 (H884Q)
Ref Sequence ENSEMBL: ENSMUSP00000052641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000054415] [ENSMUST00000106262] [ENSMUST00000106263] [ENSMUST00000121394] [ENSMUST00000131000] [ENSMUST00000205300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050383
AA Change: H884Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: H884Q

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054415
SMART Domains Protein: ENSMUSP00000056105
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106262
SMART Domains Protein: ENSMUSP00000101869
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106263
SMART Domains Protein: ENSMUSP00000101870
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121394
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131000
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Predicted Effect unknown
Transcript: ENSMUST00000206340
AA Change: H664Q
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R0930:Zfp646 UTSW 7 127883810 nonsense probably null
R1219:Zfp646 UTSW 7 127883120 missense probably benign
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127880187 unclassified probably null
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127880038 nonsense probably null
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127883477 missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTCCAGGCATCTATCAATGCTC -3'
(R):5'- CTGCTCCTTCCAAATGGCTAGGAAC -3'

Sequencing Primer
(F):5'- AATGCTCTCTCTGTCCAAAGG -3'
(R):5'- GGTCATCATAGGTCTGACCACAG -3'
Posted On2013-04-11