Incidental Mutation 'R1726:Olfr16'
ID198122
Institutional Source Beutler Lab
Gene Symbol Olfr16
Ensembl Gene ENSMUSG00000037924
Gene Nameolfactory receptor 16
SynonymsMOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1726 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172950409-172958357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172957091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000149249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038432] [ENSMUST00000215254]
Predicted Effect probably benign
Transcript: ENSMUST00000038432
AA Change: T99A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041524
Gene: ENSMUSG00000037924
AA Change: T99A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.5e-51 PFAM
Pfam:7tm_1 41 289 3.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215254
AA Change: T99A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.2085 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Olfr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr16 APN 1 172957591 missense possibly damaging 0.66
IGL00336:Olfr16 APN 1 172957478 missense probably benign 0.30
IGL01155:Olfr16 APN 1 172956924 missense probably benign 0.43
IGL01549:Olfr16 APN 1 172956974 missense probably damaging 1.00
IGL02679:Olfr16 APN 1 172957176 missense probably damaging 1.00
IGL03071:Olfr16 APN 1 172956935 missense probably benign 0.01
IGL03352:Olfr16 APN 1 172957283 missense probably benign 0.00
R0449:Olfr16 UTSW 1 172957398 missense probably damaging 1.00
R1725:Olfr16 UTSW 1 172957341 missense possibly damaging 0.90
R1735:Olfr16 UTSW 1 172956807 missense probably benign
R1928:Olfr16 UTSW 1 172957314 missense probably damaging 0.98
R4258:Olfr16 UTSW 1 172957638 missense possibly damaging 0.88
R4359:Olfr16 UTSW 1 172957080 missense probably benign
R4434:Olfr16 UTSW 1 172957544 missense probably damaging 1.00
R4666:Olfr16 UTSW 1 172957590 missense probably benign
R4874:Olfr16 UTSW 1 172957599 missense probably benign 0.00
R5063:Olfr16 UTSW 1 172957442 missense possibly damaging 0.48
R5988:Olfr16 UTSW 1 172957156 nonsense probably null
R6074:Olfr16 UTSW 1 172957378 missense probably benign 0.10
R7021:Olfr16 UTSW 1 172956927 missense probably benign 0.01
R7234:Olfr16 UTSW 1 172957106 missense probably damaging 0.96
R7527:Olfr16 UTSW 1 172956944 missense probably benign 0.00
R8271:Olfr16 UTSW 1 172957177 nonsense probably null
R8890:Olfr16 UTSW 1 172957478 missense probably benign 0.30
R8906:Olfr16 UTSW 1 172956619 start gained probably benign
Z1088:Olfr16 UTSW 1 172957324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGGAGGGGCGTTTTATTCACC -3'
(R):5'- ACATGGCTGGCACATGAAGAACTG -3'

Sequencing Primer
(F):5'- TCCAGCTTTGGAAAGCATCAG -3'
(R):5'- TGCCATAACCAGGCCAGTG -3'
Posted On2014-05-23