Mutagenetix > Incidental Mutations

Incidental Mutation 'R1726:Olfr513'

198144

Institutional Source

Beutler Lab

Gene Symbol

Olfr513

Ensembl Gene

ENSMUSG00000051200

Gene Name

olfactory receptor 513

Synonyms

MOR195-1, GA_x6K02T2PBJ9-11084889-11085818

MMRRC Submission

039758-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R1726 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108750973-108756800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108755008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 51 (S51P)

Ref Sequence

ENSEMBL: ENSMUSP00000149440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]

AlphaFold

Q8VFZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000055146
AA Change: S51P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: S51P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	307	2.7e-55	PFAM
Pfam:7TM_GPCR_Srsx	33	304	2.3e-6	PFAM
Pfam:7tm_1	39	289	2.8e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214670
AA Change: S51P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,467,868	I561T	possibly damaging	Het
Abcb5	G	C	12: 118,874,801		probably null	Het
Abcb5	A	T	12: 118,907,532	S711T	possibly damaging	Het
Acoxl	G	A	2: 127,880,446	G216R	probably damaging	Het
Arhgef18	A	T	8: 3,454,228	N949I	possibly damaging	Het
Brip1	A	T	11: 86,064,914	S924R	probably benign	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Ccdc141	A	G	2: 77,108,356		probably benign	Het
Ccdc80	A	T	16: 45,096,005	T375S	probably benign	Het
Ccl11	A	G	11: 82,061,720	K40E	possibly damaging	Het
Chrnb2	A	T	3: 89,761,202	C269S	probably damaging	Het
Dgat2	A	G	7: 99,182,416	S33P	possibly damaging	Het
Dip2c	A	G	13: 9,575,428	D608G	probably damaging	Het
Dnah2	A	T	11: 69,497,889	D889E	probably damaging	Het
Dvl2	A	T	11: 70,009,461	T694S	probably benign	Het
Fam196a	T	C	7: 134,899,138		probably benign	Het
Fbf1	A	G	11: 116,145,454	V1100A	probably benign	Het
Galt	G	A	4: 41,756,001	W22*	probably null	Het
Garem1	C	A	18: 21,148,262	V346L	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm10762	A	T	2: 128,967,215		probably benign	Het
Gm21900	A	G	Y: 10,616,358		probably null	Het
Gm2663	T	C	6: 40,998,026	Y37C	probably damaging	Het
Gm42791	C	A	5: 148,959,501		probably benign	Het
Gm5134	C	A	10: 75,992,527	P314T	possibly damaging	Het
Gtf3c2	T	C	5: 31,169,123	E348G	possibly damaging	Het
H2-T24	T	A	17: 36,015,621	M129L	probably benign	Het
Ikzf2	C	A	1: 69,548,688	R214L	probably damaging	Het
Itpr3	T	A	17: 27,111,690	L1691Q	probably damaging	Het
Kmt2c	C	T	5: 25,315,005	G2036R	probably damaging	Het
Lrp10	T	C	14: 54,469,656	L650P	probably damaging	Het
Mcm9	G	A	10: 53,537,881	P368S	possibly damaging	Het
Mob3b	A	G	4: 34,954,028	M214T	probably benign	Het
Mrpl1	T	C	5: 96,223,827	V71A	probably benign	Het
Mrpl57	A	G	14: 57,826,635	E40G	probably damaging	Het
Mtmr9	A	G	14: 63,537,098	V162A	possibly damaging	Het
Nalcn	A	T	14: 123,308,404	V1065E	probably damaging	Het
Nemp2	A	G	1: 52,637,395	D42G	probably damaging	Het
Npepps	A	G	11: 97,224,669	L623P	probably damaging	Het
Olfr16	A	G	1: 172,957,091	T99A	probably benign	Het
Olfr742	T	A	14: 50,516,179		probably null	Het
Olig3	A	G	10: 19,356,734	S36G	probably benign	Het
Pcdhb14	T	A	18: 37,449,594	Y584*	probably null	Het
Pcyox1l	T	C	18: 61,697,778	Y341C	probably benign	Het
Pdxdc1	A	C	16: 13,838,300		probably null	Het
Pias4	A	C	10: 81,155,855	V313G	probably damaging	Het
Pkd1	C	T	17: 24,564,176	T81M	probably damaging	Het
Ptprm	T	C	17: 67,042,327	I40M	probably damaging	Het
Reep6	T	C	10: 80,335,120	S277P	probably benign	Het
Shank3	A	G	15: 89,557,986	E1694G	probably damaging	Het
Shq1	T	C	6: 100,637,035	Y274C	probably benign	Het
Slc12a6	T	A	2: 112,347,426	I630N	probably damaging	Het
Slc14a1	T	A	18: 78,116,466	N15Y	probably benign	Het
Slc17a4	A	T	13: 23,905,591	Y114*	probably null	Het
Slc26a1	C	T	5: 108,673,675	G116D	probably damaging	Het
Smg8	G	T	11: 87,080,613	Y777*	probably null	Het
Tlr11	A	T	14: 50,361,541	H328L	probably benign	Het
Ube2c	G	T	2: 164,771,317	A52S	probably damaging	Het
Uhrf1bp1	C	A	17: 27,886,251		probably null	Het
Unc5c	A	G	3: 141,818,103	S806G	probably damaging	Het
Zfp874b	A	T	13: 67,474,720	I153K	probably damaging	Het
Zkscan2	T	A	7: 123,489,823	E408D	probably damaging	Het

Other mutations in Olfr513

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02491:Olfr513	APN	7	108755114	missense	probably damaging	1.00
IGL03086:Olfr513	APN	7	108755796	utr 3 prime	probably benign
FR4340:Olfr513	UTSW	7	108754954	small insertion	probably benign
IGL02799:Olfr513	UTSW	7	108755623	missense	probably benign
R0218:Olfr513	UTSW	7	108755574	nonsense	probably null
R1103:Olfr513	UTSW	7	108754883	missense	possibly damaging	0.92
R1251:Olfr513	UTSW	7	108754907	missense	probably damaging	0.99
R1450:Olfr513	UTSW	7	108755512	missense	probably damaging	1.00
R1582:Olfr513	UTSW	7	108755110	missense	probably benign	0.04
R1608:Olfr513	UTSW	7	108755102	missense	probably damaging	0.99
R1880:Olfr513	UTSW	7	108755128	missense	probably damaging	1.00
R1881:Olfr513	UTSW	7	108755128	missense	probably damaging	1.00
R2136:Olfr513	UTSW	7	108755223	missense	possibly damaging	0.58
R2216:Olfr513	UTSW	7	108755612	missense	probably damaging	1.00
R4006:Olfr513	UTSW	7	108755261	missense	probably damaging	1.00
R4603:Olfr513	UTSW	7	108755627	missense	probably damaging	1.00
R4881:Olfr513	UTSW	7	108755405	missense	probably damaging	1.00
R5132:Olfr513	UTSW	7	108755270	missense	probably damaging	1.00
R5426:Olfr513	UTSW	7	108755717	missense	possibly damaging	0.94
R5679:Olfr513	UTSW	7	108754996	missense	probably damaging	0.97
R5848:Olfr513	UTSW	7	108755574	nonsense	probably null
R5911:Olfr513	UTSW	7	108755675	missense	probably benign	0.36
R6474:Olfr513	UTSW	7	108755029	missense	probably damaging	1.00
R7016:Olfr513	UTSW	7	108755711	missense	probably damaging	1.00
R7783:Olfr513	UTSW	7	108755569	missense	probably damaging	1.00
R8113:Olfr513	UTSW	7	108755231	missense	probably damaging	1.00
R8385:Olfr513	UTSW	7	108755304	nonsense	probably null
R9429:Olfr513	UTSW	7	108755205	missense	probably damaging	0.98
Z1088:Olfr513	UTSW	7	108755104	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CAGAATCAGATATGCTGTCTGGCCC -3'
(R):5'- TCAGGAAGCCATAGGTGTAGACTCC -3'

Sequencing Primer
(F):5'- GTCTGGCCCTAGACTTAAACTGAAG -3'
(R):5'- TAGGTGTAGACTCCTATCACCAG -3'

Posted On

2014-05-23