Incidental Mutation 'R1726:Dip2c'
ID198165
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R1726 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9575428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 608 (D608G)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: D608G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: D608G

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: D608G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: D608G

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Meta Mutation Damage Score 0.1870 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc17a4 A T 13: 23,905,591 Y114* probably null Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R7925:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7928:Dip2c UTSW 13 9609044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATCCCATACTCGCTGATGAAG -3'
(R):5'- TGCTGACTGTGAACACCTTGTCC -3'

Sequencing Primer
(F):5'- TACTCGCTGATGAAGGTAAACC -3'
(R):5'- GACTGTGAACACCTTGTCCTTAAC -3'
Posted On2014-05-23