Incidental Mutation 'R1726:Slc17a4'
ID198166
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
MMRRC Submission 039758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1726 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23905591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 114 (Y114*)
Ref Sequence ENSEMBL: ENSMUSP00000153087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000225797]
Predicted Effect probably null
Transcript: ENSMUST00000021769
AA Change: Y114*
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: Y114*

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110407
AA Change: Y114*
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: Y114*

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225763
Predicted Effect probably null
Transcript: ENSMUST00000225797
AA Change: Y114*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,868 I561T possibly damaging Het
Abcb5 G C 12: 118,874,801 probably null Het
Abcb5 A T 12: 118,907,532 S711T possibly damaging Het
Acoxl G A 2: 127,880,446 G216R probably damaging Het
Arhgef18 A T 8: 3,454,228 N949I possibly damaging Het
Brip1 A T 11: 86,064,914 S924R probably benign Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc141 A G 2: 77,108,356 probably benign Het
Ccdc80 A T 16: 45,096,005 T375S probably benign Het
Ccl11 A G 11: 82,061,720 K40E possibly damaging Het
Chrnb2 A T 3: 89,761,202 C269S probably damaging Het
Dgat2 A G 7: 99,182,416 S33P possibly damaging Het
Dip2c A G 13: 9,575,428 D608G probably damaging Het
Dnah2 A T 11: 69,497,889 D889E probably damaging Het
Dvl2 A T 11: 70,009,461 T694S probably benign Het
Fam196a T C 7: 134,899,138 probably benign Het
Fbf1 A G 11: 116,145,454 V1100A probably benign Het
Galt G A 4: 41,756,001 W22* probably null Het
Garem1 C A 18: 21,148,262 V346L probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm10762 A T 2: 128,967,215 probably benign Het
Gm21900 A G Y: 10,616,358 probably null Het
Gm2663 T C 6: 40,998,026 Y37C probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5134 C A 10: 75,992,527 P314T possibly damaging Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
H2-T24 T A 17: 36,015,621 M129L probably benign Het
Ikzf2 C A 1: 69,548,688 R214L probably damaging Het
Itpr3 T A 17: 27,111,690 L1691Q probably damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrp10 T C 14: 54,469,656 L650P probably damaging Het
Mcm9 G A 10: 53,537,881 P368S possibly damaging Het
Mob3b A G 4: 34,954,028 M214T probably benign Het
Mrpl1 T C 5: 96,223,827 V71A probably benign Het
Mrpl57 A G 14: 57,826,635 E40G probably damaging Het
Mtmr9 A G 14: 63,537,098 V162A possibly damaging Het
Nalcn A T 14: 123,308,404 V1065E probably damaging Het
Nemp2 A G 1: 52,637,395 D42G probably damaging Het
Npepps A G 11: 97,224,669 L623P probably damaging Het
Olfr16 A G 1: 172,957,091 T99A probably benign Het
Olfr513 T C 7: 108,755,008 S51P probably benign Het
Olfr742 T A 14: 50,516,179 probably null Het
Olig3 A G 10: 19,356,734 S36G probably benign Het
Pcdhb14 T A 18: 37,449,594 Y584* probably null Het
Pcyox1l T C 18: 61,697,778 Y341C probably benign Het
Pdxdc1 A C 16: 13,838,300 probably null Het
Pias4 A C 10: 81,155,855 V313G probably damaging Het
Pkd1 C T 17: 24,564,176 T81M probably damaging Het
Ptprm T C 17: 67,042,327 I40M probably damaging Het
Reep6 T C 10: 80,335,120 S277P probably benign Het
Shank3 A G 15: 89,557,986 E1694G probably damaging Het
Shq1 T C 6: 100,637,035 Y274C probably benign Het
Slc12a6 T A 2: 112,347,426 I630N probably damaging Het
Slc14a1 T A 18: 78,116,466 N15Y probably benign Het
Slc26a1 C T 5: 108,673,675 G116D probably damaging Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Tlr11 A T 14: 50,361,541 H328L probably benign Het
Ube2c G T 2: 164,771,317 A52S probably damaging Het
Uhrf1bp1 C A 17: 27,886,251 probably null Het
Unc5c A G 3: 141,818,103 S806G probably damaging Het
Zfp874b A T 13: 67,474,720 I153K probably damaging Het
Zkscan2 T A 7: 123,489,823 E408D probably damaging Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4581001:Slc17a4 UTSW 13 23902018 missense probably damaging 0.99
PIT4696001:Slc17a4 UTSW 13 23900514 missense probably benign 0.02
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3838:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 splice site probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
R7744:Slc17a4 UTSW 13 23901784 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGACAATGAGCAAGGCTACTCCAG -3'
(R):5'- CCCAAGTGAATTTTGTGGCTCACTG -3'

Sequencing Primer
(F):5'- GGCTACTCCAGCATCAGC -3'
(R):5'- ggcacggctataatttcaagac -3'
Posted On2014-05-23