Incidental Mutation 'R0084:Unc13d'
ID19821
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Nameunc-13 homolog D (C. elegans)
Synonyms2610108D09Rik, Munc13-4, Jinx
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116062095-116077961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116063831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 984 (V984M)
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000106452] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably benign
Transcript: ENSMUST00000021116
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075036
AA Change: V984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948
AA Change: V984M

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106450
AA Change: V986M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948
AA Change: V986M

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106451
AA Change: V986M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948
AA Change: V986M

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106452
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173943
Predicted Effect probably damaging
Transcript: ENSMUST00000174822
AA Change: V984M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948
AA Change: V984M

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.7981 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 116074403 missense probably damaging 0.99
IGL00976:Unc13d APN 11 116070467 missense probably damaging 1.00
IGL01630:Unc13d APN 11 116073866 missense probably benign 0.00
IGL01761:Unc13d APN 11 116073869 missense probably damaging 1.00
IGL01772:Unc13d APN 11 116076532 missense possibly damaging 0.91
IGL01935:Unc13d APN 11 116069751 missense probably benign
IGL02486:Unc13d APN 11 116069806 splice site probably benign
IGL02503:Unc13d APN 11 116068802 missense possibly damaging 0.82
IGL02519:Unc13d APN 11 116070533 missense probably damaging 1.00
IGL02524:Unc13d APN 11 116070319 missense probably damaging 1.00
IGL02634:Unc13d APN 11 116070556 splice site probably benign
IGL02636:Unc13d APN 11 116073618 missense probably damaging 1.00
IGL03243:Unc13d APN 11 116067844 missense probably benign 0.34
jinx UTSW 11 116073423 unclassified probably benign
R0033:Unc13d UTSW 11 116069165 missense probably benign 0.00
R0122:Unc13d UTSW 11 116065482 missense probably benign 0.00
R0422:Unc13d UTSW 11 116070020 critical splice donor site probably null
R0666:Unc13d UTSW 11 116069492 splice site probably benign
R1019:Unc13d UTSW 11 116068074 missense probably benign 0.03
R1333:Unc13d UTSW 11 116073555 splice site probably benign
R1484:Unc13d UTSW 11 116073875 missense possibly damaging 0.72
R1594:Unc13d UTSW 11 116068712 missense probably benign 0.04
R1597:Unc13d UTSW 11 116074436 missense probably benign 0.02
R1603:Unc13d UTSW 11 116073655 missense possibly damaging 0.86
R1662:Unc13d UTSW 11 116068673 missense probably null 1.00
R1909:Unc13d UTSW 11 116070295 missense probably damaging 0.99
R2015:Unc13d UTSW 11 116068755 missense probably damaging 1.00
R2313:Unc13d UTSW 11 116063734 missense probably damaging 1.00
R2435:Unc13d UTSW 11 116068688 missense probably damaging 1.00
R4705:Unc13d UTSW 11 116073388 missense possibly damaging 0.70
R4732:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4733:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4792:Unc13d UTSW 11 116070282 missense probably damaging 1.00
R4843:Unc13d UTSW 11 116074259 missense probably damaging 1.00
R5496:Unc13d UTSW 11 116066708 missense probably damaging 1.00
R5571:Unc13d UTSW 11 116063654 missense probably benign 0.00
R5589:Unc13d UTSW 11 116069753 missense probably damaging 0.99
R5838:Unc13d UTSW 11 116064625 missense possibly damaging 0.80
R6058:Unc13d UTSW 11 116073568 critical splice donor site probably null
R6266:Unc13d UTSW 11 116068238 missense probably damaging 1.00
R6807:Unc13d UTSW 11 116066751 missense probably damaging 0.98
R7085:Unc13d UTSW 11 116064807 missense probably benign 0.07
R7098:Unc13d UTSW 11 116063726 missense probably damaging 1.00
R7269:Unc13d UTSW 11 116068230 missense probably benign 0.01
R7291:Unc13d UTSW 11 116074050 missense possibly damaging 0.79
R7453:Unc13d UTSW 11 116067871 missense probably benign
R7486:Unc13d UTSW 11 116074433 missense possibly damaging 0.68
R7618:Unc13d UTSW 11 116066721 missense probably damaging 1.00
R7817:Unc13d UTSW 11 116076283 missense probably damaging 1.00
R7952:Unc13d UTSW 11 116064941 intron probably null
X0027:Unc13d UTSW 11 116069756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGAAGTCACATGACACTGCC -3'
(R):5'- TCCAGGGAAGGATGCTGTATCCAAG -3'

Sequencing Primer
(F):5'- CTCTCCATTAGACGAGAGCTTGG -3'
(R):5'- AAGGCCCCTTGTTGTAAAATCC -3'
Posted On2013-04-11