Incidental Mutation 'R1727:Cdk5rap2'
ID198212
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission 039759-MU
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R1727 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70272679 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1043 (D1043G)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: D1043G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D1043G

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency 96% (98/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,428,964 probably benign Het
Ak2 C T 4: 129,007,763 P159L probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Akr1a1 A G 4: 116,641,051 L99P probably damaging Het
Anxa8 T A 14: 34,089,590 M34K probably damaging Het
Axl T G 7: 25,760,766 D767A possibly damaging Het
B430305J03Rik A G 3: 61,363,878 probably benign Het
Cdh24 A T 14: 54,638,638 Y182* probably null Het
Cep120 T C 18: 53,727,729 M210V probably benign Het
Chga C T 12: 102,561,437 H117Y possibly damaging Het
Cnga4 T C 7: 105,405,754 W79R probably damaging Het
Cntnap5b C T 1: 100,213,744 T575I possibly damaging Het
Col6a3 T A 1: 90,796,574 probably null Het
Copz2 T C 11: 96,853,475 V71A probably benign Het
Dennd3 G T 15: 73,565,128 R1068L possibly damaging Het
Dhrs7 T C 12: 72,659,464 T56A probably damaging Het
Dnah17 G A 11: 118,070,489 T2557I probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Eif3b T C 5: 140,425,322 I176T probably damaging Het
Eif4b T A 15: 102,090,062 D392E possibly damaging Het
Eif4h T C 5: 134,639,280 Y7C probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Epg5 T A 18: 78,015,815 V1928E possibly damaging Het
Erbin T A 13: 103,827,968 E1222V probably benign Het
Fam160b2 C A 14: 70,593,998 G32V probably damaging Het
Fhdc1 T A 3: 84,446,176 I581F possibly damaging Het
Fstl4 A C 11: 53,068,651 Q173P probably damaging Het
Gm266 A G 12: 111,485,479 F98L possibly damaging Het
Gsdmc2 T C 15: 63,849,779 probably benign Het
Gtf2h3 A G 5: 124,590,356 Q156R probably benign Het
H2-T23 T C 17: 36,031,653 T198A possibly damaging Het
Il1r1 C A 1: 40,293,264 A68E probably benign Het
Kcna7 A T 7: 45,409,506 I406F possibly damaging Het
Lbr A G 1: 181,819,916 I432T probably benign Het
Lnx1 A T 5: 74,607,916 probably null Het
Lrrcc1 T A 3: 14,537,363 I50N probably damaging Het
Lss T C 10: 76,539,844 V237A possibly damaging Het
Mcm10 A G 2: 5,006,525 F212L probably benign Het
Methig1 A C 15: 100,353,249 I14L probably benign Het
Mrpl41 A T 2: 24,974,624 V55E probably damaging Het
Mtfp1 C A 11: 4,093,982 D83Y probably damaging Het
Myh1 T A 11: 67,210,466 probably benign Het
Myo1e T C 9: 70,376,524 F834S possibly damaging Het
Ndufs7 A T 10: 80,256,019 probably benign Het
Nlrp4e T A 7: 23,320,995 N302K probably benign Het
Nt5e T A 9: 88,328,029 M115K possibly damaging Het
Nup153 A T 13: 46,693,785 C723S probably damaging Het
Obox6 G A 7: 15,834,577 P125S probably benign Het
Olfr1104 A G 2: 87,022,263 F94L probably damaging Het
Olfr235 T G 19: 12,269,001 I257S possibly damaging Het
Olfr330 A T 11: 58,529,516 S157T possibly damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr665 C T 7: 104,881,514 T269I probably benign Het
Pcdh1 A C 18: 38,203,032 Y44* probably null Het
Pcdhb6 A T 18: 37,334,587 D187V probably damaging Het
Pclo A G 5: 14,676,987 probably benign Het
Pdcl3 T A 1: 38,995,755 I80K possibly damaging Het
Pde12 A T 14: 26,668,867 V229E probably benign Het
Plcg1 A G 2: 160,748,088 E142G probably benign Het
Plxnb1 A G 9: 109,101,057 probably null Het
Pnpla1 A G 17: 28,878,534 I225V probably benign Het
Polr2f A G 15: 79,144,605 probably benign Het
Prob1 A G 18: 35,654,311 S297P possibly damaging Het
Qsox2 A C 2: 26,220,958 S132A probably benign Het
Rab19 T A 6: 39,388,161 Y118* probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptn T C 3: 93,397,138 S593P possibly damaging Het
Sept11 T C 5: 93,156,924 I200T probably damaging Het
Slc10a4 T A 5: 73,016,148 probably benign Het
Slc9c1 A T 16: 45,601,961 I1130F probably benign Het
Slit3 C T 11: 35,629,832 R599C probably damaging Het
Snx19 C T 9: 30,433,366 P622L probably damaging Het
Sspo T C 6: 48,494,848 L50P probably damaging Het
St8sia1 A T 6: 142,876,727 C137S probably damaging Het
Syt11 G C 3: 88,761,952 T211S possibly damaging Het
Tanc1 A C 2: 59,790,809 Y324S probably damaging Het
Tas2r136 T C 6: 132,777,790 I125V possibly damaging Het
Tbc1d15 A T 10: 115,210,225 W458R probably damaging Het
Tctex1d2 T A 16: 32,422,933 M78K probably benign Het
Tecta G T 9: 42,359,301 T1237N probably damaging Het
Tet2 T A 3: 133,487,290 D461V probably damaging Het
Tmco3 G A 8: 13,318,866 V573M possibly damaging Het
Tmem212 A T 3: 27,884,812 M175K probably benign Het
Traf6 A G 2: 101,696,739 H278R probably benign Het
Trerf1 T A 17: 47,341,166 noncoding transcript Het
Ttn A C 2: 76,746,644 V24635G probably damaging Het
Ush1c A T 7: 46,209,231 D544E probably damaging Het
Usp47 C T 7: 112,086,100 T586M probably damaging Het
Vmn2r1 T A 3: 64,081,742 M34K probably benign Het
Vmn2r102 T A 17: 19,677,508 W262R probably damaging Het
Wasf3 C T 5: 146,466,959 A293V probably benign Het
Xrn2 A G 2: 147,061,516 Q812R probably benign Het
Zc3h7b T C 15: 81,768,029 I10T probably damaging Het
Zfp747 A T 7: 127,374,077 L307Q probably damaging Het
Zfp777 A T 6: 48,043,890 F266Y probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCGAAGAGTCTGATGCTAGACC -3'
(R):5'- TGCTCTGTACACTTGCTGAGACCC -3'

Sequencing Primer
(F):5'- GAGTCTGATGCTAGACCATTAAGTCC -3'
(R):5'- GGTATCTCAACATCTCAGAAGCTG -3'
Posted On2014-05-23