Incidental Mutation 'R1727:Cdk5rap2'
ID 198212
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 039759-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R1727 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70190916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1043 (D1043G)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: D1043G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D1043G

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency 96% (98/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,565,472 (GRCm39) probably benign Het
Ak2 C T 4: 128,901,556 (GRCm39) P159L probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Akr1a1 A G 4: 116,498,248 (GRCm39) L99P probably damaging Het
Anxa8 T A 14: 33,811,547 (GRCm39) M34K probably damaging Het
Axl T G 7: 25,460,191 (GRCm39) D767A possibly damaging Het
B430305J03Rik A G 3: 61,271,299 (GRCm39) probably benign Het
Cdh24 A T 14: 54,876,095 (GRCm39) Y182* probably null Het
Cep120 T C 18: 53,860,801 (GRCm39) M210V probably benign Het
Chga C T 12: 102,527,696 (GRCm39) H117Y possibly damaging Het
Cnga4 T C 7: 105,054,961 (GRCm39) W79R probably damaging Het
Cntnap5b C T 1: 100,141,469 (GRCm39) T575I possibly damaging Het
Col6a3 T A 1: 90,724,296 (GRCm39) probably null Het
Copz2 T C 11: 96,744,301 (GRCm39) V71A probably benign Het
Dennd3 G T 15: 73,436,977 (GRCm39) R1068L possibly damaging Het
Dhrs7 T C 12: 72,706,238 (GRCm39) T56A probably damaging Het
Dnah17 G A 11: 117,961,315 (GRCm39) T2557I probably damaging Het
Dnah17 A T 11: 117,987,362 (GRCm39) L1320* probably null Het
Dynlt2b T A 16: 32,241,751 (GRCm39) M78K probably benign Het
Eif3b T C 5: 140,411,077 (GRCm39) I176T probably damaging Het
Eif4b T A 15: 101,998,497 (GRCm39) D392E possibly damaging Het
Eif4h T C 5: 134,668,134 (GRCm39) Y7C probably damaging Het
Enam A T 5: 88,651,853 (GRCm39) S1046C probably damaging Het
Epg5 T A 18: 78,059,030 (GRCm39) V1928E possibly damaging Het
Erbin T A 13: 103,964,476 (GRCm39) E1222V probably benign Het
Fhdc1 T A 3: 84,353,483 (GRCm39) I581F possibly damaging Het
Fhip2b C A 14: 70,831,438 (GRCm39) G32V probably damaging Het
Fstl4 A C 11: 52,959,478 (GRCm39) Q173P probably damaging Het
Gm266 A G 12: 111,451,913 (GRCm39) F98L possibly damaging Het
Gsdmc2 T C 15: 63,721,628 (GRCm39) probably benign Het
Gtf2h3 A G 5: 124,728,419 (GRCm39) Q156R probably benign Het
H2-T23 T C 17: 36,342,545 (GRCm39) T198A possibly damaging Het
Il1r1 C A 1: 40,332,424 (GRCm39) A68E probably benign Het
Kcna7 A T 7: 45,058,930 (GRCm39) I406F possibly damaging Het
Lbr A G 1: 181,647,481 (GRCm39) I432T probably benign Het
Lnx1 A T 5: 74,768,577 (GRCm39) probably null Het
Lrrcc1 T A 3: 14,602,423 (GRCm39) I50N probably damaging Het
Lss T C 10: 76,375,678 (GRCm39) V237A possibly damaging Het
Mcm10 A G 2: 5,011,336 (GRCm39) F212L probably benign Het
Methig1 A C 15: 100,251,130 (GRCm39) I14L probably benign Het
Mrpl41 A T 2: 24,864,636 (GRCm39) V55E probably damaging Het
Mtfp1 C A 11: 4,043,982 (GRCm39) D83Y probably damaging Het
Myh1 T A 11: 67,101,292 (GRCm39) probably benign Het
Myo1e T C 9: 70,283,806 (GRCm39) F834S possibly damaging Het
Ndufs7 A T 10: 80,091,853 (GRCm39) probably benign Het
Nlrp4e T A 7: 23,020,420 (GRCm39) N302K probably benign Het
Nt5e T A 9: 88,210,082 (GRCm39) M115K possibly damaging Het
Nup153 A T 13: 46,847,261 (GRCm39) C723S probably damaging Het
Obox6 G A 7: 15,568,502 (GRCm39) P125S probably benign Het
Or1n2 G A 2: 36,797,405 (GRCm39) C149Y probably benign Het
Or2t48 A T 11: 58,420,342 (GRCm39) S157T possibly damaging Het
Or52n3 C T 7: 104,530,721 (GRCm39) T269I probably benign Het
Or5an11 T G 19: 12,246,365 (GRCm39) I257S possibly damaging Het
Or8i2 A G 2: 86,852,607 (GRCm39) F94L probably damaging Het
Pcdh1 A C 18: 38,336,085 (GRCm39) Y44* probably null Het
Pcdhb6 A T 18: 37,467,640 (GRCm39) D187V probably damaging Het
Pclo A G 5: 14,727,001 (GRCm39) probably benign Het
Pdcl3 T A 1: 39,034,836 (GRCm39) I80K possibly damaging Het
Pde12 A T 14: 26,390,022 (GRCm39) V229E probably benign Het
Plcg1 A G 2: 160,590,008 (GRCm39) E142G probably benign Het
Plxnb1 A G 9: 108,930,125 (GRCm39) probably null Het
Pnpla1 A G 17: 29,097,508 (GRCm39) I225V probably benign Het
Polr2f A G 15: 79,028,805 (GRCm39) probably benign Het
Prob1 A G 18: 35,787,364 (GRCm39) S297P possibly damaging Het
Qsox2 A C 2: 26,110,970 (GRCm39) S132A probably benign Het
Rab19 T A 6: 39,365,095 (GRCm39) Y118* probably null Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rptn T C 3: 93,304,445 (GRCm39) S593P possibly damaging Het
Septin11 T C 5: 93,304,783 (GRCm39) I200T probably damaging Het
Slc10a4 T A 5: 73,173,491 (GRCm39) probably benign Het
Slc9c1 A T 16: 45,422,324 (GRCm39) I1130F probably benign Het
Slit3 C T 11: 35,520,659 (GRCm39) R599C probably damaging Het
Snx19 C T 9: 30,344,662 (GRCm39) P622L probably damaging Het
Sspo T C 6: 48,471,782 (GRCm39) L50P probably damaging Het
St8sia1 A T 6: 142,822,453 (GRCm39) C137S probably damaging Het
Syt11 G C 3: 88,669,259 (GRCm39) T211S possibly damaging Het
Tanc1 A C 2: 59,621,153 (GRCm39) Y324S probably damaging Het
Tas2r136 T C 6: 132,754,753 (GRCm39) I125V possibly damaging Het
Tbc1d15 A T 10: 115,046,130 (GRCm39) W458R probably damaging Het
Tecta G T 9: 42,270,597 (GRCm39) T1237N probably damaging Het
Tet2 T A 3: 133,193,051 (GRCm39) D461V probably damaging Het
Tmco3 G A 8: 13,368,866 (GRCm39) V573M possibly damaging Het
Tmem212 A T 3: 27,938,961 (GRCm39) M175K probably benign Het
Traf6 A G 2: 101,527,084 (GRCm39) H278R probably benign Het
Trerf1 T A 17: 47,652,092 (GRCm39) noncoding transcript Het
Ttn A C 2: 76,576,988 (GRCm39) V24635G probably damaging Het
Ush1c A T 7: 45,858,655 (GRCm39) D544E probably damaging Het
Usp47 C T 7: 111,685,307 (GRCm39) T586M probably damaging Het
Vmn2r1 T A 3: 63,989,163 (GRCm39) M34K probably benign Het
Vmn2r102 T A 17: 19,897,770 (GRCm39) W262R probably damaging Het
Wasf3 C T 5: 146,403,769 (GRCm39) A293V probably benign Het
Xrn2 A G 2: 146,903,436 (GRCm39) Q812R probably benign Het
Zc3h7b T C 15: 81,652,230 (GRCm39) I10T probably damaging Het
Zfp747 A T 7: 126,973,249 (GRCm39) L307Q probably damaging Het
Zfp777 A T 6: 48,020,824 (GRCm39) F266Y probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCGAAGAGTCTGATGCTAGACC -3'
(R):5'- TGCTCTGTACACTTGCTGAGACCC -3'

Sequencing Primer
(F):5'- GAGTCTGATGCTAGACCATTAAGTCC -3'
(R):5'- GGTATCTCAACATCTCAGAAGCTG -3'
Posted On 2014-05-23