Incidental Mutation 'R0084:Dcaf11'
ID19826
Institutional Source Beutler Lab
Gene Symbol Dcaf11
Ensembl Gene ENSMUSG00000022214
Gene NameDDB1 and CUL4 associated factor 11
Synonyms0710008A13Rik, GLO14, D14Ucla1, Wdr23
MMRRC Submission 038371-MU
Accession Numbers

Genbank: NM_133734; MGI: 90168

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55560006-55570065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55569243 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 468 (R468C)
Ref Sequence ENSEMBL: ENSMUSP00000113620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072530] [ENSMUST00000117236] [ENSMUST00000117701] [ENSMUST00000121622] [ENSMUST00000128490] [ENSMUST00000143375] [ENSMUST00000150019] [ENSMUST00000150481] [ENSMUST00000152681]
Predicted Effect probably benign
Transcript: ENSMUST00000072530
AA Change: R508C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072344
Gene: ENSMUSG00000022214
AA Change: R508C

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117236
AA Change: R508C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113014
Gene: ENSMUSG00000022214
AA Change: R508C

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117701
AA Change: R468C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113620
Gene: ENSMUSG00000022214
AA Change: R468C

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WD40 122 160 8.91e-1 SMART
WD40 165 206 8.25e0 SMART
WD40 212 253 2.39e0 SMART
WD40 256 296 1.44e-5 SMART
WD40 304 343 1.26e-5 SMART
WD40 384 429 1.72e0 SMART
WD40 432 471 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121622
AA Change: R508C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113202
Gene: ENSMUSG00000022214
AA Change: R508C

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128490
AA Change: R508C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114211
Gene: ENSMUSG00000022214
AA Change: R508C

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000143375
SMART Domains Protein: ENSMUSP00000121570
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145983
Predicted Effect probably benign
Transcript: ENSMUST00000150019
SMART Domains Protein: ENSMUSP00000117617
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150481
SMART Domains Protein: ENSMUSP00000119001
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152681
SMART Domains Protein: ENSMUSP00000120296
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155029
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Dcaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Dcaf11 APN 14 55561285 utr 5 prime probably benign
IGL02158:Dcaf11 APN 14 55564523 splice site probably null
IGL02487:Dcaf11 APN 14 55569114 missense probably benign 0.06
IGL02887:Dcaf11 APN 14 55564135 missense probably damaging 1.00
IGL03263:Dcaf11 APN 14 55565492 missense probably damaging 0.99
IGL03392:Dcaf11 APN 14 55561421 missense probably damaging 1.00
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0110:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0450:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0510:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0662:Dcaf11 UTSW 14 55565507 missense possibly damaging 0.93
R1087:Dcaf11 UTSW 14 55569124 missense probably damaging 0.96
R2281:Dcaf11 UTSW 14 55569371 makesense probably null
R2698:Dcaf11 UTSW 14 55566885 missense probably damaging 1.00
R2866:Dcaf11 UTSW 14 55565745 missense possibly damaging 0.92
R4472:Dcaf11 UTSW 14 55565606 intron probably benign
R5288:Dcaf11 UTSW 14 55563376 missense probably damaging 1.00
R5682:Dcaf11 UTSW 14 55563426 missense probably damaging 1.00
R5706:Dcaf11 UTSW 14 55565695 missense probably damaging 1.00
R7133:Dcaf11 UTSW 14 55568926 intron probably null
R7468:Dcaf11 UTSW 14 55565509 missense possibly damaging 0.70
R7673:Dcaf11 UTSW 14 55569305 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGTATATGACCTCTTGAGCGGC -3'
(R):5'- TTCTCACCCAGTGTGAGCAGTTCC -3'

Sequencing Primer
(F):5'- GCCACATTGTTAAGAAGCTGAC -3'
(R):5'- AGTGTGAGCAGTTCCTCCAC -3'
Posted On2013-04-11