Incidental Mutation 'R1727:Slc9c1'
ID198278
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission 039759-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R1727 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45601961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1130 (I1130F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: I1130F

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I1130F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency 96% (98/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,428,964 probably benign Het
Ak2 C T 4: 129,007,763 P159L probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Akr1a1 A G 4: 116,641,051 L99P probably damaging Het
Anxa8 T A 14: 34,089,590 M34K probably damaging Het
Axl T G 7: 25,760,766 D767A possibly damaging Het
B430305J03Rik A G 3: 61,363,878 probably benign Het
Cdh24 A T 14: 54,638,638 Y182* probably null Het
Cdk5rap2 T C 4: 70,272,679 D1043G probably benign Het
Cdk5rap2 A T 4: 70,289,972 S746T possibly damaging Het
Cep120 T C 18: 53,727,729 M210V probably benign Het
Chga C T 12: 102,561,437 H117Y possibly damaging Het
Cnga4 T C 7: 105,405,754 W79R probably damaging Het
Cntnap5b C T 1: 100,213,744 T575I possibly damaging Het
Col6a3 T A 1: 90,796,574 probably null Het
Copz2 T C 11: 96,853,475 V71A probably benign Het
Dennd3 G T 15: 73,565,128 R1068L possibly damaging Het
Dhrs7 T C 12: 72,659,464 T56A probably damaging Het
Dnah17 G A 11: 118,070,489 T2557I probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Eif3b T C 5: 140,425,322 I176T probably damaging Het
Eif4b T A 15: 102,090,062 D392E possibly damaging Het
Eif4h T C 5: 134,639,280 Y7C probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Epg5 T A 18: 78,015,815 V1928E possibly damaging Het
Erbin T A 13: 103,827,968 E1222V probably benign Het
Fam160b2 C A 14: 70,593,998 G32V probably damaging Het
Fhdc1 T A 3: 84,446,176 I581F possibly damaging Het
Fstl4 A C 11: 53,068,651 Q173P probably damaging Het
Gm266 A G 12: 111,485,479 F98L possibly damaging Het
Gsdmc2 T C 15: 63,849,779 probably benign Het
Gtf2h3 A G 5: 124,590,356 Q156R probably benign Het
H2-T23 T C 17: 36,031,653 T198A possibly damaging Het
Il1r1 C A 1: 40,293,264 A68E probably benign Het
Kcna7 A T 7: 45,409,506 I406F possibly damaging Het
Lbr A G 1: 181,819,916 I432T probably benign Het
Lnx1 A T 5: 74,607,916 probably null Het
Lrrcc1 T A 3: 14,537,363 I50N probably damaging Het
Lss T C 10: 76,539,844 V237A possibly damaging Het
Mcm10 A G 2: 5,006,525 F212L probably benign Het
Methig1 A C 15: 100,353,249 I14L probably benign Het
Mrpl41 A T 2: 24,974,624 V55E probably damaging Het
Mtfp1 C A 11: 4,093,982 D83Y probably damaging Het
Myh1 T A 11: 67,210,466 probably benign Het
Myo1e T C 9: 70,376,524 F834S possibly damaging Het
Ndufs7 A T 10: 80,256,019 probably benign Het
Nlrp4e T A 7: 23,320,995 N302K probably benign Het
Nt5e T A 9: 88,328,029 M115K possibly damaging Het
Nup153 A T 13: 46,693,785 C723S probably damaging Het
Obox6 G A 7: 15,834,577 P125S probably benign Het
Olfr1104 A G 2: 87,022,263 F94L probably damaging Het
Olfr235 T G 19: 12,269,001 I257S possibly damaging Het
Olfr330 A T 11: 58,529,516 S157T possibly damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr665 C T 7: 104,881,514 T269I probably benign Het
Pcdh1 A C 18: 38,203,032 Y44* probably null Het
Pcdhb6 A T 18: 37,334,587 D187V probably damaging Het
Pclo A G 5: 14,676,987 probably benign Het
Pdcl3 T A 1: 38,995,755 I80K possibly damaging Het
Pde12 A T 14: 26,668,867 V229E probably benign Het
Plcg1 A G 2: 160,748,088 E142G probably benign Het
Plxnb1 A G 9: 109,101,057 probably null Het
Pnpla1 A G 17: 28,878,534 I225V probably benign Het
Polr2f A G 15: 79,144,605 probably benign Het
Prob1 A G 18: 35,654,311 S297P possibly damaging Het
Qsox2 A C 2: 26,220,958 S132A probably benign Het
Rab19 T A 6: 39,388,161 Y118* probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptn T C 3: 93,397,138 S593P possibly damaging Het
Sept11 T C 5: 93,156,924 I200T probably damaging Het
Slc10a4 T A 5: 73,016,148 probably benign Het
Slit3 C T 11: 35,629,832 R599C probably damaging Het
Snx19 C T 9: 30,433,366 P622L probably damaging Het
Sspo T C 6: 48,494,848 L50P probably damaging Het
St8sia1 A T 6: 142,876,727 C137S probably damaging Het
Syt11 G C 3: 88,761,952 T211S possibly damaging Het
Tanc1 A C 2: 59,790,809 Y324S probably damaging Het
Tas2r136 T C 6: 132,777,790 I125V possibly damaging Het
Tbc1d15 A T 10: 115,210,225 W458R probably damaging Het
Tctex1d2 T A 16: 32,422,933 M78K probably benign Het
Tecta G T 9: 42,359,301 T1237N probably damaging Het
Tet2 T A 3: 133,487,290 D461V probably damaging Het
Tmco3 G A 8: 13,318,866 V573M possibly damaging Het
Tmem212 A T 3: 27,884,812 M175K probably benign Het
Traf6 A G 2: 101,696,739 H278R probably benign Het
Trerf1 T A 17: 47,341,166 noncoding transcript Het
Ttn A C 2: 76,746,644 V24635G probably damaging Het
Ush1c A T 7: 46,209,231 D544E probably damaging Het
Usp47 C T 7: 112,086,100 T586M probably damaging Het
Vmn2r1 T A 3: 64,081,742 M34K probably benign Het
Vmn2r102 T A 17: 19,677,508 W262R probably damaging Het
Wasf3 C T 5: 146,466,959 A293V probably benign Het
Xrn2 A G 2: 147,061,516 Q812R probably benign Het
Zc3h7b T C 15: 81,768,029 I10T probably damaging Het
Zfp747 A T 7: 127,374,077 L307Q probably damaging Het
Zfp777 A T 6: 48,043,890 F266Y probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTCATTCCAGCAGTCAGCAAG -3'
(R):5'- TGCCTCCTAGATACCATGAGGAGC -3'

Sequencing Primer
(F):5'- GCAAGCTGAAGACCTAGTATACCAG -3'
(R):5'- gcaagaaaactcgcaccc -3'
Posted On2014-05-23