Incidental Mutation 'R0084:Apba1'
ID19831
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0084 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23912497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 420 (S420P)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025830
AA Change: S420P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: S420P

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pax2 T A 19: 44,818,435 Y290N probably damaging Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
R7495:Apba1 UTSW 19 23936599 critical splice donor site probably null
Z1176:Apba1 UTSW 19 23944115 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGCTCAGTGCAGTTTGCAATTC -3'
(R):5'- AACACTGTGGCCTGCAACTACC -3'

Sequencing Primer
(F):5'- GCAATTCTTCTTGCCAAAAAGTC -3'
(R):5'- TGGCTTTCACTGACAAACGG -3'
Posted On2013-04-11