Incidental Mutation 'R0084:Pax2'
ID19832
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Namepaired box 2
SynonymsPax-2, Opdc
MMRRC Submission 038371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0084 (G1)
Quality Score107
Status Validated
Chromosome19
Chromosomal Location44756045-44837871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44818435 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 290 (Y290N)
Ref Sequence ENSEMBL: ENSMUSP00000004340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]
Predicted Effect probably damaging
Transcript: ENSMUST00000004340
AA Change: Y290N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: Y290N

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172880
AA Change: Y291N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134174
Gene: ENSMUSG00000004231
AA Change: Y291N

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 247 281 7e-5 SMART
Pfam:Pax2_C 304 415 5.5e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173346
AA Change: Y264N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231
AA Change: Y264N

DomainStartEndE-ValueType
PAX 20 144 2.3e-96 SMART
low complexity region 170 182 N/A INTRINSIC
SCOP:d1ftt__ 220 254 5e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174490
AA Change: Y268N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: Y268N

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.7055 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Abca8a A G 11: 110,036,597 probably benign Het
Abcc9 A G 6: 142,658,551 Y653H probably damaging Het
Acpp A T 9: 104,314,365 S241T probably benign Het
Acvr1 A G 2: 58,458,883 probably null Het
Adgb T C 10: 10,396,344 N832S possibly damaging Het
AI182371 A G 2: 35,085,702 probably null Het
Anapc1 G A 2: 128,623,966 probably benign Het
Apba1 T C 19: 23,912,497 S420P possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
BC025446 T A 15: 75,217,775 M44K probably benign Het
Bpifb2 A T 2: 153,891,091 M365L probably benign Het
Btnl9 A T 11: 49,178,779 N224K possibly damaging Het
Cntn1 A T 15: 92,317,917 I944L probably benign Het
Cpa3 T C 3: 20,242,101 probably benign Het
Dcaf11 C T 14: 55,569,243 R468C probably benign Het
E4f1 T C 17: 24,444,082 T750A possibly damaging Het
Ercc5 A G 1: 44,175,976 K890E possibly damaging Het
Fbrsl1 A G 5: 110,379,515 L262P probably damaging Het
Flnb A G 14: 7,935,979 D2273G probably benign Het
Gm14085 A G 2: 122,522,833 Y498C possibly damaging Het
Gm9848 A T 13: 113,108,242 noncoding transcript Het
Hcrtr1 T A 4: 130,137,266 H75L possibly damaging Het
Heatr9 A T 11: 83,512,895 probably benign Het
Htatip2 G A 7: 49,759,672 G58D probably damaging Het
Lmntd1 G A 6: 145,404,528 H234Y unknown Het
Map4k3 T C 17: 80,655,914 K85E possibly damaging Het
Moxd2 T C 6: 40,879,408 D510G probably null Het
Mpv17l2 A T 8: 70,764,545 probably benign Het
Nbeal2 A G 9: 110,643,710 probably null Het
Ncapd3 A G 9: 27,056,111 D581G probably damaging Het
Ndufb5 T C 3: 32,737,203 V33A probably benign Het
Olfr517 A T 7: 108,868,800 M118K probably damaging Het
Osbpl1a T C 18: 12,757,612 T524A probably benign Het
Otogl A C 10: 107,901,341 S71A probably damaging Het
Ovol2 G T 2: 144,305,888 N180K probably damaging Het
Pam A G 1: 97,896,049 V219A probably benign Het
Paox C T 7: 140,132,446 R197* probably null Het
Pik3ca T C 3: 32,462,788 M933T possibly damaging Het
Ppfia4 G T 1: 134,299,426 R1124S possibly damaging Het
Prkch T C 12: 73,697,987 F258S possibly damaging Het
Rhob G A 12: 8,499,107 R176C probably benign Het
Sbf2 A T 7: 110,442,366 I326N possibly damaging Het
Scgb2b2 A T 7: 31,303,616 E45D probably benign Het
Scube3 T A 17: 28,162,961 D320E probably benign Het
Serpina1f A G 12: 103,693,588 V145A possibly damaging Het
Slc6a5 A C 7: 49,930,013 I380L probably benign Het
Spag16 A G 1: 69,996,839 N342S probably benign Het
Spata16 A G 3: 26,667,410 T27A possibly damaging Het
Spock3 A C 8: 63,143,929 K89T probably damaging Het
Tbc1d1 T C 5: 64,324,454 V795A probably damaging Het
Tirap G T 9: 35,189,162 H75Q probably benign Het
Tpk1 C A 6: 43,346,829 V229L possibly damaging Het
Tshz2 A G 2: 169,884,366 H294R probably damaging Het
Ttn A T 2: 76,872,699 probably benign Het
Unc13d C T 11: 116,063,831 V984M probably damaging Het
Zbtb43 A T 2: 33,453,984 Y373N probably damaging Het
Zfp646 T A 7: 127,881,304 H884Q possibly damaging Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44790688 missense probably damaging 0.99
IGL02368:Pax2 APN 19 44835409 missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44833275 splice site probably benign
bradybunch UTSW 19 44790736 missense probably damaging 0.99
R0554:Pax2 UTSW 19 44761861 missense probably damaging 1.00
R1116:Pax2 UTSW 19 44757424 missense probably damaging 0.99
R1951:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1952:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1981:Pax2 UTSW 19 44818465 missense probably damaging 1.00
R3015:Pax2 UTSW 19 44816024 missense probably damaging 1.00
R4320:Pax2 UTSW 19 44835399 missense probably damaging 0.97
R4561:Pax2 UTSW 19 44835963 missense unknown
R4562:Pax2 UTSW 19 44835963 missense unknown
R4661:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R4948:Pax2 UTSW 19 44816040 missense probably damaging 1.00
R5131:Pax2 UTSW 19 44760955 missense probably damaging 0.98
R5622:Pax2 UTSW 19 44818466 missense probably damaging 1.00
R5661:Pax2 UTSW 19 44790722 missense probably damaging 1.00
R6110:Pax2 UTSW 19 44790736 missense probably damaging 0.99
R6171:Pax2 UTSW 19 44790740 missense probably damaging 1.00
R6713:Pax2 UTSW 19 44835477 missense unknown
R6791:Pax2 UTSW 19 44788821 missense possibly damaging 0.69
R7156:Pax2 UTSW 19 44788859 missense probably benign 0.00
R7679:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R7695:Pax2 UTSW 19 44833199 missense probably damaging 1.00
R8005:Pax2 UTSW 19 44760889 missense probably damaging 1.00
X0018:Pax2 UTSW 19 44796676 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGACCGAATCTCCACTCAGCGTG -3'
(R):5'- CAGGCTGAAGCCCAGATTTCTGAC -3'

Sequencing Primer
(F):5'- TCCACTCAGCGTGTCAGG -3'
(R):5'- ctctctccctctctctctctc -3'
Posted On2013-04-11