Mutagenetix > Incidental Mutation

Incidental Mutation 'R0085:Cfi'

19841

Institutional Source

Beutler Lab

Gene Symbol

Cfi

Ensembl Gene

ENSMUSG00000058952

Gene Name

complement component factor i

Synonyms

MMRRC Submission

038372-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0085 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129835884-129875332 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129874986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 554 (I554V)

Ref Sequence

ENSEMBL: ENSMUSP00000077074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029629] [ENSMUST00000077918]

AlphaFold

Q61129

Predicted Effect

probably benign
Transcript: ENSMUST00000029629

SMART Domains

Protein: ENSMUSP00000029629
Gene: ENSMUSG00000027999

Domain	Start	End	E-Value	Type
Pfam:PLA2G12	14	192	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000077918
AA Change: I554V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: I554V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	4.63e-38	SMART
KAZAL	63	109	6.91e-3	SMART
SR	117	220	2.95e-22	SMART
LDLa	225	262	1.07e-4	SMART
LDLa	263	300	7.16e-6	SMART
low complexity region	317	326	N/A	INTRINSIC
Tryp_SPc	360	589	3.33e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196838

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.4%

Validation Efficiency

95% (71/75)

MGI Phenotype

FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	A	3: 88,711,739	S583R	probably damaging	Het
Acad12	A	G	5: 121,604,294	I417T	possibly damaging	Het
Adcy9	T	C	16: 4,288,224	T1009A	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Baat	T	C	4: 49,490,425		probably benign	Het
Bpi	T	A	2: 158,273,152	L311*	probably null	Het
Brd2	A	C	17: 34,113,259	F294L	probably damaging	Het
Carmil1	T	A	13: 24,025,867	E804D	probably benign	Het
Cd209g	A	T	8: 4,134,785		probably benign	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Dst	T	C	1: 34,229,187	S2897P	probably damaging	Het
Efcab7	T	C	4: 99,904,680		probably benign	Het
Fbxo2	T	C	4: 148,164,910		probably null	Het
Fgfr2	C	A	7: 130,196,263	R400L	probably damaging	Het
Hsd17b14	T	C	7: 45,556,410		probably benign	Het
Il23r	T	C	6: 67,486,222	N96D	probably damaging	Het
Ints13	T	A	6: 146,574,787		probably benign	Het
Lig1	A	G	7: 13,307,570	I776V	possibly damaging	Het
Madd	T	C	2: 91,162,738	I997V	probably benign	Het
Mgat4b	C	T	11: 50,230,999	H116Y	possibly damaging	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myo5b	A	C	18: 74,701,680	D937A	probably benign	Het
Nox3	T	C	17: 3,635,281	N584S	probably benign	Het
Ogfr	A	G	2: 180,591,037		probably null	Het
Olfr1341	T	C	4: 118,709,881	V158A	probably benign	Het
Olfr741	T	A	14: 50,486,334	M292K	probably benign	Het
Olfr904	T	C	9: 38,464,662	I207T	probably benign	Het
Osbpl6	G	T	2: 76,593,414	V728F	probably benign	Het
Picalm	T	A	7: 90,182,317	S453T	probably benign	Het
Piezo1	A	G	8: 122,501,615	L310P	probably damaging	Het
Pitrm1	C	T	13: 6,549,568		probably benign	Het
Pkd1	T	C	17: 24,586,223	F3250L	probably damaging	Het
Plekha4	C	T	7: 45,543,949	R376*	probably null	Het
Pnmal2	A	T	7: 16,945,549	S153C	unknown	Het
Rp1l1	C	T	14: 64,022,295	R129W	probably damaging	Het
Ryr3	A	G	2: 112,859,763	V1147A	probably damaging	Het
Sema3d	G	A	5: 12,570,986	V520I	probably benign	Het
Sgsm1	A	G	5: 113,279,270		probably benign	Het
Slc13a2	A	G	11: 78,406,868	V58A	probably damaging	Het
Slc1a4	A	G	11: 20,304,510		probably benign	Het
Slc4a10	G	A	2: 62,244,346		probably benign	Het
Tab1	G	T	15: 80,155,893	A305S	probably benign	Het
Tmem30a	T	A	9: 79,771,294	T327S	probably benign	Het
Tpr	A	C	1: 150,417,413	E863A	possibly damaging	Het
Upk3bl	A	G	5: 136,060,115	N161D	probably benign	Het
Ush1c	T	A	7: 46,225,555	I131F	probably benign	Het
Wdfy4	C	A	14: 33,078,243	R1975S	possibly damaging	Het
Zbtb18	C	T	1: 177,447,935	A287V	probably benign	Het
Zfp712	T	C	13: 67,041,192	T424A	probably benign	Het
Zfp791	G	T	8: 85,112,233	Y56*	probably null	Het

Other mutations in Cfi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Cfi	APN	3	129873095	missense	probably damaging	0.97
IGL00659:Cfi	APN	3	129836813	missense	unknown
IGL01310:Cfi	APN	3	129858431	missense	probably damaging	1.00
IGL01387:Cfi	APN	3	129874913	unclassified	probably benign
IGL01897:Cfi	APN	3	129858385	missense	probably damaging	1.00
IGL02418:Cfi	APN	3	129848812	missense	probably benign	0.20
F5770:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0835:Cfi	UTSW	3	129868542	missense	probably damaging	1.00
R1191:Cfi	UTSW	3	129868527	missense	probably benign	0.01
R1221:Cfi	UTSW	3	129872969	missense	probably damaging	0.99
R1576:Cfi	UTSW	3	129873050	missense	probably damaging	0.98
R1809:Cfi	UTSW	3	129873119	critical splice donor site	probably null
R1940:Cfi	UTSW	3	129858828	splice site	probably benign
R1983:Cfi	UTSW	3	129868545	missense	probably damaging	1.00
R2069:Cfi	UTSW	3	129858804	splice site	probably null
R3012:Cfi	UTSW	3	129874930	missense	probably damaging	1.00
R4334:Cfi	UTSW	3	129850829	missense	possibly damaging	0.80
R4596:Cfi	UTSW	3	129868500	missense	probably damaging	0.98
R4888:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5121:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5322:Cfi	UTSW	3	129873040	missense	probably damaging	1.00
R5673:Cfi	UTSW	3	129855009	missense	probably benign	0.02
R6084:Cfi	UTSW	3	129858370	missense	probably benign	0.00
R6364:Cfi	UTSW	3	129872846	missense	probably benign	0.36
R6770:Cfi	UTSW	3	129858730	missense	probably benign	0.21
R7000:Cfi	UTSW	3	129872873	missense	probably damaging	1.00
R7108:Cfi	UTSW	3	129875016	missense	probably damaging	1.00
R7194:Cfi	UTSW	3	129855059	missense	probably damaging	1.00
R7342:Cfi	UTSW	3	129875132	missense	probably damaging	1.00
R7470:Cfi	UTSW	3	129855087	missense	probably benign	0.01
R7538:Cfi	UTSW	3	129858815	missense	probably benign	0.08
R7908:Cfi	UTSW	3	129848584	missense	probably benign	0.01
R7954:Cfi	UTSW	3	129868585	critical splice donor site	probably null
R8017:Cfi	UTSW	3	129855099	missense	probably benign	0.00
R8135:Cfi	UTSW	3	129855000	missense	probably benign	0.00
R8155:Cfi	UTSW	3	129855090	missense	probably benign	0.00
R8217:Cfi	UTSW	3	129855001	missense	possibly damaging	0.61
R8530:Cfi	UTSW	3	129850733	missense	possibly damaging	0.79
R8767:Cfi	UTSW	3	129850848	critical splice donor site	probably null
R9578:Cfi	UTSW	3	129865375	missense	probably benign
R9590:Cfi	UTSW	3	129848812	missense	probably benign	0.02
R9774:Cfi	UTSW	3	129874996	missense	probably damaging	0.99
V7580:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGCAAGTCCTTCTGTGCATCAGTG -3'
(R):5'- CTTGCCAGCTCTGAGGAGAACTAAC -3'

Sequencing Primer
(F):5'- CAGTGTTGGGGAGGCAG -3'
(R):5'- CAGCTCTGAGGAGAACTAACTATAC -3'

Posted On

2013-04-11