Incidental Mutation 'R1728:Dnah11'
ID 198604
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, b2b1289Clo, b2b1203Clo, Dnahc11, avc4, b2b1279Clo, b2b1727Clo, lrd
MMRRC Submission 039760-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.661) question?
Stock # R1728 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 117841717-118162778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117880666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 3818 (D3818V)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: D3818V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: D3818V

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176239
Predicted Effect probably benign
Transcript: ENSMUST00000176756
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 223 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,844 (GRCm39) probably benign Het
Aadat A G 8: 60,979,746 (GRCm39) T203A probably damaging Het
Abca13 T A 11: 9,199,680 (GRCm39) F104L probably benign Het
Acox1 T A 11: 116,089,109 (GRCm39) probably null Het
Adam34l T C 8: 44,078,620 (GRCm39) N535D probably damaging Het
Adamts17 C T 7: 66,799,704 (GRCm39) R1060* probably null Het
Adgrg6 T C 10: 14,315,526 (GRCm39) T593A probably damaging Het
Ankrd12 G T 17: 66,291,071 (GRCm39) P1454Q probably benign Het
Ap2m1 T A 16: 20,358,088 (GRCm39) N35K probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Atr G A 9: 95,779,634 (GRCm39) V1331I probably benign Het
Bola1 C T 3: 96,104,426 (GRCm39) G56D probably benign Het
Brsk1 A G 7: 4,707,218 (GRCm39) D257G probably damaging Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Cbs G T 17: 31,839,923 (GRCm39) A337E probably benign Het
Ccdc186 A C 19: 56,797,652 (GRCm39) H306Q probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Chrnb1 C A 11: 69,676,588 (GRCm39) D388Y probably damaging Het
Clcn1 T A 6: 42,276,448 (GRCm39) F360Y possibly damaging Het
Clgn A G 8: 84,149,659 (GRCm39) S387G probably damaging Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Coil G A 11: 88,864,802 (GRCm39) V10I probably damaging Het
Col4a1 G A 8: 11,262,712 (GRCm39) P1256S possibly damaging Het
Copa T A 1: 171,939,554 (GRCm39) F597Y probably benign Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crybg1 T A 10: 43,880,015 (GRCm39) Q391L probably damaging Het
Cspg4 G T 9: 56,805,821 (GRCm39) V2211L probably benign Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dhx30 T C 9: 109,927,819 (GRCm39) H101R probably damaging Het
Dnah17 C T 11: 117,960,345 (GRCm39) C2572Y possibly damaging Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Ehf T G 2: 103,104,251 (GRCm39) T186P possibly damaging Het
En1 A G 1: 120,531,350 (GRCm39) S197G unknown Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Fam187b C T 7: 30,688,445 (GRCm39) Q268* probably null Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fat3 A C 9: 15,907,611 (GRCm39) V2797G possibly damaging Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A G 1: 130,732,306 (GRCm39) R98G probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Fut10 T A 8: 31,691,418 (GRCm39) S88T probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Glrx2 C T 1: 143,615,478 (GRCm39) A27V possibly damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Gse1 G A 8: 121,294,992 (GRCm39) probably benign Het
Heatr4 T C 12: 84,014,346 (GRCm39) I630M probably benign Het
Hectd4 A T 5: 121,439,902 (GRCm39) Y1134F possibly damaging Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ildr1 A T 16: 36,528,698 (GRCm39) T48S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 CTC CTCTTC 1: 135,314,009 (GRCm39) probably benign Het
Itprid1 T C 6: 55,945,526 (GRCm39) F749S probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcnh5 T C 12: 75,184,465 (GRCm39) D86G probably benign Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif1b T C 4: 149,272,179 (GRCm39) T1541A probably damaging Het
Kif21b A G 1: 136,087,859 (GRCm39) I983V possibly damaging Het
Kif26a T C 12: 112,143,219 (GRCm39) S1158P possibly damaging Het
Kmt2d A G 15: 98,763,013 (GRCm39) C279R probably damaging Het
Kpna3 T A 14: 61,605,150 (GRCm39) E499V probably benign Het
Krt16 T C 11: 100,138,533 (GRCm39) E205G probably damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Mb21d2 A G 16: 28,647,173 (GRCm39) V267A probably benign Het
Mfrp A G 9: 44,015,884 (GRCm39) T334A possibly damaging Het
Morc1 T A 16: 48,432,660 (GRCm39) D709E probably benign Het
Mrgpra2b A G 7: 47,114,627 (GRCm39) I35T probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Mycbp2 A T 14: 103,392,614 (GRCm39) C3206S probably damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ndufaf7 A T 17: 79,245,058 (GRCm39) K59M probably damaging Het
Necab3 T C 2: 154,388,795 (GRCm39) S208G probably benign Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or3a1c A G 11: 74,046,802 (GRCm39) D274G probably damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or5m13b T A 2: 85,754,466 (GRCm39) L285I possibly damaging Het
Or8b12i A T 9: 20,082,209 (GRCm39) Y219* probably null Het
Otoa T C 7: 120,724,662 (GRCm39) V447A probably benign Het
Papss1 A G 3: 131,311,728 (GRCm39) N319D probably benign Het
Patj G A 4: 98,320,017 (GRCm39) G428D possibly damaging Het
Pcdhb3 G A 18: 37,434,931 (GRCm39) G299D probably damaging Het
Pcsk4 T C 10: 80,159,404 (GRCm39) D432G probably damaging Het
Pde5a G T 3: 122,541,889 (GRCm39) L126F probably damaging Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pinx1 A G 14: 64,115,559 (GRCm39) probably null Het
Plec C A 15: 76,061,892 (GRCm39) E2547* probably null Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prrx1 T A 1: 163,089,536 (GRCm39) N97I probably damaging Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rbsn A T 6: 92,167,000 (GRCm39) L548Q possibly damaging Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C A 1: 133,286,720 (GRCm39) probably null Het
Ren1 A C 1: 133,284,195 (GRCm39) K187Q probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep G C 1: 135,211,715 (GRCm39) A11G probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Ryr2 C T 13: 11,602,308 (GRCm39) V4525M possibly damaging Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Sis A T 3: 72,872,978 (GRCm39) C53* probably null Het
Slc13a5 C T 11: 72,157,285 (GRCm39) probably null Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc9a8 T C 2: 167,266,065 (GRCm39) F14S probably benign Het
Spock3 T C 8: 63,802,011 (GRCm39) L330P probably damaging Het
Stab2 T G 10: 86,773,903 (GRCm39) R809S probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Tecta G A 9: 42,303,218 (GRCm39) T138I probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Traf7 A G 17: 24,731,353 (GRCm39) F228L probably damaging Het
Trhr A G 15: 44,060,549 (GRCm39) E23G probably damaging Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Tubgcp2 T C 7: 139,577,968 (GRCm39) T779A probably benign Het
Tusc2 A T 9: 107,441,830 (GRCm39) I68F probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Upf2 A T 2: 6,032,261 (GRCm39) S191C probably damaging Het
Usp24 A G 4: 106,217,618 (GRCm39) N447S possibly damaging Het
Usp42 T C 5: 143,700,381 (GRCm39) D1214G probably damaging Het
Vcam1 T A 3: 115,908,164 (GRCm39) I633L probably benign Het
Vmn2r73 T C 7: 85,507,086 (GRCm39) Y742C probably damaging Het
Vmn2r81 C A 10: 79,106,489 (GRCm39) T489K probably benign Het
Ypel1 C G 16: 16,907,283 (GRCm39) probably benign Het
Zan C A 5: 137,413,280 (GRCm39) probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zfp616 A C 11: 73,976,597 (GRCm39) K955N probably damaging Het
Zfyve9 A C 4: 108,575,698 (GRCm39) V461G possibly damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118,162,480 (GRCm39) missense probably benign 0.28
IGL00422:Dnah11 APN 12 118,031,831 (GRCm39) missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118,000,194 (GRCm39) missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118,150,657 (GRCm39) missense probably benign 0.01
IGL00687:Dnah11 APN 12 117,885,739 (GRCm39) splice site probably benign
IGL00833:Dnah11 APN 12 118,143,315 (GRCm39) missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117,874,937 (GRCm39) missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118,160,386 (GRCm39) missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118,106,669 (GRCm39) splice site probably benign
IGL01121:Dnah11 APN 12 118,014,430 (GRCm39) missense probably benign 0.02
IGL01143:Dnah11 APN 12 117,976,475 (GRCm39) missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117,946,734 (GRCm39) missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118,156,134 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118,010,991 (GRCm39) nonsense probably null
IGL01418:Dnah11 APN 12 117,951,217 (GRCm39) nonsense probably null
IGL01444:Dnah11 APN 12 117,983,967 (GRCm39) missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117,946,767 (GRCm39) missense probably benign 0.15
IGL01645:Dnah11 APN 12 118,150,733 (GRCm39) missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118,156,005 (GRCm39) splice site probably benign
IGL02104:Dnah11 APN 12 118,156,125 (GRCm39) missense probably benign
IGL02151:Dnah11 APN 12 118,023,623 (GRCm39) splice site probably benign
IGL02189:Dnah11 APN 12 118,046,314 (GRCm39) missense probably benign 0.00
IGL02417:Dnah11 APN 12 118,020,915 (GRCm39) missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118,150,637 (GRCm39) missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117,939,608 (GRCm39) splice site probably benign
IGL02474:Dnah11 APN 12 117,991,180 (GRCm39) splice site probably null
IGL02526:Dnah11 APN 12 118,143,353 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117,874,775 (GRCm39) missense probably damaging 1.00
IGL03011:Dnah11 APN 12 117,976,112 (GRCm39) missense probably benign 0.08
IGL03061:Dnah11 APN 12 117,866,856 (GRCm39) missense probably damaging 1.00
IGL03182:Dnah11 APN 12 117,994,026 (GRCm39) missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118,069,720 (GRCm39) missense probably benign
IGL03238:Dnah11 APN 12 118,073,633 (GRCm39) missense probably damaging 1.00
IGL03493:Dnah11 APN 12 117,976,533 (GRCm39) missense probably benign 0.00
P0045:Dnah11 UTSW 12 117,994,062 (GRCm39) missense probably benign
R0009:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118,090,621 (GRCm39) missense probably benign 0.05
R0172:Dnah11 UTSW 12 117,951,188 (GRCm39) missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118,007,509 (GRCm39) missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117,946,791 (GRCm39) nonsense probably null
R0270:Dnah11 UTSW 12 118,004,748 (GRCm39) missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118,090,868 (GRCm39) missense probably benign 0.03
R0325:Dnah11 UTSW 12 117,976,074 (GRCm39) missense probably benign
R0370:Dnah11 UTSW 12 117,958,962 (GRCm39) missense probably benign
R0416:Dnah11 UTSW 12 117,874,793 (GRCm39) missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118,070,245 (GRCm39) missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably benign 0.01
R0607:Dnah11 UTSW 12 118,046,246 (GRCm39) missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117,951,204 (GRCm39) missense probably damaging 1.00
R0635:Dnah11 UTSW 12 117,971,731 (GRCm39) missense probably damaging 1.00
R0755:Dnah11 UTSW 12 118,162,360 (GRCm39) missense probably benign 0.17
R0755:Dnah11 UTSW 12 117,918,564 (GRCm39) missense possibly damaging 0.95
R0789:Dnah11 UTSW 12 117,874,967 (GRCm39) missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0835:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118,160,397 (GRCm39) missense probably benign 0.01
R0846:Dnah11 UTSW 12 117,897,585 (GRCm39) missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118,154,579 (GRCm39) nonsense probably null
R0928:Dnah11 UTSW 12 118,009,297 (GRCm39) missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118,024,142 (GRCm39) missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117,897,547 (GRCm39) missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117,936,099 (GRCm39) missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118,020,841 (GRCm39) nonsense probably null
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118,002,430 (GRCm39) missense probably damaging 1.00
R1500:Dnah11 UTSW 12 117,976,564 (GRCm39) splice site probably null
R1535:Dnah11 UTSW 12 117,982,465 (GRCm39) missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117,894,991 (GRCm39) missense probably benign 0.01
R1554:Dnah11 UTSW 12 118,046,234 (GRCm39) missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118,024,052 (GRCm39) missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R1618:Dnah11 UTSW 12 117,979,200 (GRCm39) missense probably damaging 0.98
R1638:Dnah11 UTSW 12 117,979,154 (GRCm39) missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118,084,459 (GRCm39) missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117,897,580 (GRCm39) missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118,154,603 (GRCm39) missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118,160,379 (GRCm39) missense probably benign 0.32
R1729:Dnah11 UTSW 12 117,880,666 (GRCm39) missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118,154,560 (GRCm39) missense probably benign 0.31
R1780:Dnah11 UTSW 12 117,991,293 (GRCm39) missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118,002,515 (GRCm39) missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118,027,587 (GRCm39) missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118,091,291 (GRCm39) missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117,880,523 (GRCm39) missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118,046,203 (GRCm39) missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118,077,606 (GRCm39) missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 117,976,451 (GRCm39) missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 117,984,088 (GRCm39) missense probably damaging 1.00
R2140:Dnah11 UTSW 12 117,972,545 (GRCm39) missense probably benign 0.01
R2261:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2261:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2262:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2263:Dnah11 UTSW 12 117,930,374 (GRCm39) missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117,843,760 (GRCm39) missense probably benign 0.06
R2328:Dnah11 UTSW 12 117,850,421 (GRCm39) missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117,892,065 (GRCm39) missense probably damaging 1.00
R2410:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117,951,162 (GRCm39) nonsense probably null
R3499:Dnah11 UTSW 12 117,874,758 (GRCm39) missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3742:Dnah11 UTSW 12 118,095,076 (GRCm39) missense probably benign 0.05
R3779:Dnah11 UTSW 12 118,094,448 (GRCm39) splice site probably benign
R3785:Dnah11 UTSW 12 117,981,337 (GRCm39) missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117,942,188 (GRCm39) splice site probably benign
R4014:Dnah11 UTSW 12 117,938,649 (GRCm39) missense probably benign 0.16
R4043:Dnah11 UTSW 12 117,843,678 (GRCm39) missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118,070,227 (GRCm39) missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4074:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4076:Dnah11 UTSW 12 118,009,413 (GRCm39) missense probably benign 0.01
R4201:Dnah11 UTSW 12 117,930,394 (GRCm39) missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118,094,627 (GRCm39) missense probably benign 0.06
R4233:Dnah11 UTSW 12 117,880,526 (GRCm39) missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118,089,578 (GRCm39) nonsense probably null
R4430:Dnah11 UTSW 12 117,946,746 (GRCm39) missense probably benign 0.26
R4465:Dnah11 UTSW 12 117,951,186 (GRCm39) missense probably benign 0.09
R4489:Dnah11 UTSW 12 117,880,631 (GRCm39) missense probably benign 0.31
R4572:Dnah11 UTSW 12 117,973,860 (GRCm39) missense probably benign 0.00
R4574:Dnah11 UTSW 12 117,975,990 (GRCm39) critical splice donor site probably null
R4657:Dnah11 UTSW 12 118,156,162 (GRCm39) missense probably benign 0.02
R4709:Dnah11 UTSW 12 117,982,495 (GRCm39) missense probably benign 0.26
R4740:Dnah11 UTSW 12 118,084,279 (GRCm39) missense probably benign 0.28
R4803:Dnah11 UTSW 12 118,091,343 (GRCm39) missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117,958,935 (GRCm39) missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118,090,618 (GRCm39) missense probably benign 0.37
R5018:Dnah11 UTSW 12 118,094,463 (GRCm39) missense probably benign 0.00
R5071:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5074:Dnah11 UTSW 12 118,046,188 (GRCm39) nonsense probably null
R5080:Dnah11 UTSW 12 118,162,565 (GRCm39) start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 117,981,435 (GRCm39) missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117,918,486 (GRCm39) missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118,121,096 (GRCm39) missense probably benign 0.09
R5252:Dnah11 UTSW 12 118,089,676 (GRCm39) missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117,847,151 (GRCm39) missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118,049,415 (GRCm39) missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117,918,628 (GRCm39) missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118,049,432 (GRCm39) missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118,070,209 (GRCm39) missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117,844,186 (GRCm39) critical splice donor site probably null
R5546:Dnah11 UTSW 12 117,939,583 (GRCm39) missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 117,982,537 (GRCm39) missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117,847,352 (GRCm39) missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118,077,642 (GRCm39) missense probably benign 0.04
R5706:Dnah11 UTSW 12 117,987,670 (GRCm39) missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118,090,841 (GRCm39) missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118,156,125 (GRCm39) missense probably benign
R5884:Dnah11 UTSW 12 118,141,269 (GRCm39) missense probably benign 0.00
R5900:Dnah11 UTSW 12 118,046,166 (GRCm39) splice site probably null
R5905:Dnah11 UTSW 12 117,918,659 (GRCm39) missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117,878,371 (GRCm39) splice site probably null
R5973:Dnah11 UTSW 12 118,074,687 (GRCm39) missense probably benign 0.02
R6024:Dnah11 UTSW 12 117,994,007 (GRCm39) missense probably benign 0.34
R6056:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign 0.03
R6075:Dnah11 UTSW 12 118,068,586 (GRCm39) missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117,892,191 (GRCm39) missense probably benign
R6191:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R6197:Dnah11 UTSW 12 118,143,482 (GRCm39) missense probably benign 0.03
R6262:Dnah11 UTSW 12 117,894,913 (GRCm39) missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118,106,027 (GRCm39) missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117,880,590 (GRCm39) missense probably benign 0.01
R6614:Dnah11 UTSW 12 117,850,411 (GRCm39) missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118,150,617 (GRCm39) splice site probably null
R6712:Dnah11 UTSW 12 118,014,457 (GRCm39) missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118,009,381 (GRCm39) missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118,077,629 (GRCm39) missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117,951,411 (GRCm39) splice site probably null
R6895:Dnah11 UTSW 12 117,958,926 (GRCm39) missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118,070,297 (GRCm39) missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118,162,503 (GRCm39) missense probably benign
R6945:Dnah11 UTSW 12 118,024,045 (GRCm39) missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117,897,544 (GRCm39) missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118,072,679 (GRCm39) missense probably benign 0.00
R6976:Dnah11 UTSW 12 118,162,378 (GRCm39) missense probably benign 0.16
R7000:Dnah11 UTSW 12 117,981,396 (GRCm39) missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117,885,753 (GRCm39) frame shift probably null
R7101:Dnah11 UTSW 12 118,031,880 (GRCm39) missense probably benign
R7106:Dnah11 UTSW 12 117,924,884 (GRCm39) missense probably benign 0.15
R7203:Dnah11 UTSW 12 118,009,257 (GRCm39) missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118,090,624 (GRCm39) missense probably benign 0.00
R7219:Dnah11 UTSW 12 118,004,830 (GRCm39) missense possibly damaging 0.95
R7308:Dnah11 UTSW 12 117,959,010 (GRCm39) missense probably damaging 1.00
R7361:Dnah11 UTSW 12 117,982,477 (GRCm39) missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117,951,177 (GRCm39) missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118,089,520 (GRCm39) missense probably damaging 1.00
R7399:Dnah11 UTSW 12 117,991,212 (GRCm39) missense probably benign 0.00
R7404:Dnah11 UTSW 12 118,068,543 (GRCm39) missense probably benign 0.36
R7473:Dnah11 UTSW 12 117,866,911 (GRCm39) missense probably benign 0.19
R7545:Dnah11 UTSW 12 117,894,939 (GRCm39) missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118,104,505 (GRCm39) splice site probably null
R7625:Dnah11 UTSW 12 118,160,377 (GRCm39) missense probably benign
R7761:Dnah11 UTSW 12 117,987,648 (GRCm39) missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118,004,744 (GRCm39) missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117,951,237 (GRCm39) missense probably benign 0.04
R7904:Dnah11 UTSW 12 117,867,003 (GRCm39) missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117,930,368 (GRCm39) missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117,842,284 (GRCm39) missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 117,976,181 (GRCm39) missense probably benign
R8254:Dnah11 UTSW 12 117,842,259 (GRCm39) missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 117,991,243 (GRCm39) nonsense probably null
R8272:Dnah11 UTSW 12 118,074,752 (GRCm39) missense probably benign 0.01
R8344:Dnah11 UTSW 12 118,049,466 (GRCm39) missense probably benign 0.00
R8515:Dnah11 UTSW 12 117,939,533 (GRCm39) missense probably damaging 1.00
R8528:Dnah11 UTSW 12 117,972,538 (GRCm39) missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117,842,247 (GRCm39) missense probably benign
R8676:Dnah11 UTSW 12 118,154,539 (GRCm39) missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118,049,384 (GRCm39) critical splice donor site probably null
R8773:Dnah11 UTSW 12 117,958,950 (GRCm39) missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117,874,764 (GRCm39) missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8866:Dnah11 UTSW 12 118,156,107 (GRCm39) missense probably benign 0.03
R8881:Dnah11 UTSW 12 118,090,550 (GRCm39) missense probably benign 0.05
R8881:Dnah11 UTSW 12 118,077,647 (GRCm39) missense probably benign 0.00
R8920:Dnah11 UTSW 12 118,077,674 (GRCm39) missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118,091,381 (GRCm39) missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 117,987,718 (GRCm39) missense probably benign 0.36
R8962:Dnah11 UTSW 12 117,918,630 (GRCm39) missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117,916,273 (GRCm39) missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118,094,578 (GRCm39) missense probably benign 0.00
R9155:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9162:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9164:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117,894,918 (GRCm39) missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118,154,632 (GRCm39) missense probably benign
R9205:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9208:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117,951,095 (GRCm39) missense probably damaging 1.00
R9264:Dnah11 UTSW 12 117,991,262 (GRCm39) missense probably damaging 1.00
R9290:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9291:Dnah11 UTSW 12 117,991,251 (GRCm39) missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118,143,341 (GRCm39) missense probably benign 0.11
R9353:Dnah11 UTSW 12 118,143,434 (GRCm39) missense probably benign 0.00
R9375:Dnah11 UTSW 12 117,884,703 (GRCm39) missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118,141,290 (GRCm39) missense probably benign 0.00
R9392:Dnah11 UTSW 12 118,011,055 (GRCm39) nonsense probably null
R9433:Dnah11 UTSW 12 117,976,007 (GRCm39) missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117,878,352 (GRCm39) missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118,150,711 (GRCm39) missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117,938,728 (GRCm39) missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 117,982,513 (GRCm39) missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118,094,770 (GRCm39) missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118,024,148 (GRCm39) missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117,842,311 (GRCm39) nonsense probably null
R9764:Dnah11 UTSW 12 117,884,704 (GRCm39) missense probably benign 0.05
RF023:Dnah11 UTSW 12 117,918,585 (GRCm39) missense probably damaging 1.00
RF047:Dnah11 UTSW 12 117,973,818 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,858,747 (GRCm39) missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117,946,704 (GRCm39) missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 118,094,534 (GRCm39) missense probably damaging 0.97
Z1176:Dnah11 UTSW 12 118,090,854 (GRCm39) missense probably benign 0.00
Z1176:Dnah11 UTSW 12 117,894,912 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CACATTGCTCACCTCAGGGCATAC -3'
(R):5'- CCATCCACCAAGGCTTCTCATTGAC -3'

Sequencing Primer
(F):5'- GGCATACGTCATCCTGTCAG -3'
(R):5'- CTGACCCTTAGTCTAAGCAGG -3'
Posted On 2014-05-23