Incidental Mutation 'R0085:Clvs2'
ID19863
Institutional Source Beutler Lab
Gene Symbol Clvs2
Ensembl Gene ENSMUSG00000019785
Gene Nameclavesin 2
SynonymsRlbp1l2, A330019N05Rik
MMRRC Submission 038372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0085 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33512286-33624769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 33622546 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 129 (S129R)
Ref Sequence ENSEMBL: ENSMUSP00000151805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019920] [ENSMUST00000160299] [ENSMUST00000161692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019920
AA Change: S129R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019920
Gene: ENSMUSG00000019785
AA Change: S129R

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
SEC14 96 254 1.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159533
Predicted Effect possibly damaging
Transcript: ENSMUST00000160299
AA Change: S129R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125100
Gene: ENSMUSG00000019785
AA Change: S129R

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
Pfam:CRAL_TRIO 98 219 8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160756
Predicted Effect possibly damaging
Transcript: ENSMUST00000161692
AA Change: S129R

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217704
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the SEC14/CRAL-TRIO family of proteins. A similar protein in rat is thought to function in the endosomal pathway between early endosomes and mature lysosomes. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,711,739 S583R probably damaging Het
Acad12 A G 5: 121,604,294 I417T possibly damaging Het
Adcy9 T C 16: 4,288,224 T1009A probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baat T C 4: 49,490,425 probably benign Het
Bpi T A 2: 158,273,152 L311* probably null Het
Brd2 A C 17: 34,113,259 F294L probably damaging Het
Carmil1 T A 13: 24,025,867 E804D probably benign Het
Cd209g A T 8: 4,134,785 probably benign Het
Cfi A G 3: 129,874,986 I554V probably benign Het
Dst T C 1: 34,229,187 S2897P probably damaging Het
Efcab7 T C 4: 99,904,680 probably benign Het
Fbxo2 T C 4: 148,164,910 probably null Het
Fgfr2 C A 7: 130,196,263 R400L probably damaging Het
Hsd17b14 T C 7: 45,556,410 probably benign Het
Il23r T C 6: 67,486,222 N96D probably damaging Het
Ints13 T A 6: 146,574,787 probably benign Het
Lig1 A G 7: 13,307,570 I776V possibly damaging Het
Madd T C 2: 91,162,738 I997V probably benign Het
Mgat4b C T 11: 50,230,999 H116Y possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo5b A C 18: 74,701,680 D937A probably benign Het
Nox3 T C 17: 3,635,281 N584S probably benign Het
Ogfr A G 2: 180,591,037 probably null Het
Olfr1341 T C 4: 118,709,881 V158A probably benign Het
Olfr741 T A 14: 50,486,334 M292K probably benign Het
Olfr904 T C 9: 38,464,662 I207T probably benign Het
Osbpl6 G T 2: 76,593,414 V728F probably benign Het
Picalm T A 7: 90,182,317 S453T probably benign Het
Piezo1 A G 8: 122,501,615 L310P probably damaging Het
Pitrm1 C T 13: 6,549,568 probably benign Het
Pkd1 T C 17: 24,586,223 F3250L probably damaging Het
Plekha4 C T 7: 45,543,949 R376* probably null Het
Pnmal2 A T 7: 16,945,549 S153C unknown Het
Rp1l1 C T 14: 64,022,295 R129W probably damaging Het
Ryr3 A G 2: 112,859,763 V1147A probably damaging Het
Sema3d G A 5: 12,570,986 V520I probably benign Het
Sgsm1 A G 5: 113,279,270 probably benign Het
Slc13a2 A G 11: 78,406,868 V58A probably damaging Het
Slc1a4 A G 11: 20,304,510 probably benign Het
Slc4a10 G A 2: 62,244,346 probably benign Het
Tab1 G T 15: 80,155,893 A305S probably benign Het
Tmem30a T A 9: 79,771,294 T327S probably benign Het
Tpr A C 1: 150,417,413 E863A possibly damaging Het
Upk3bl A G 5: 136,060,115 N161D probably benign Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Wdfy4 C A 14: 33,078,243 R1975S possibly damaging Het
Zbtb18 C T 1: 177,447,935 A287V probably benign Het
Zfp712 T C 13: 67,041,192 T424A probably benign Het
Zfp791 G T 8: 85,112,233 Y56* probably null Het
Other mutations in Clvs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Clvs2 APN 10 33528463 missense probably benign 0.03
IGL02304:Clvs2 APN 10 33528447 missense probably benign 0.02
IGL02967:Clvs2 APN 10 33595788 missense probably damaging 0.98
R0346:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R1228:Clvs2 UTSW 10 33622604 missense probably benign 0.05
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R2176:Clvs2 UTSW 10 33595815 missense probably damaging 1.00
R2280:Clvs2 UTSW 10 33528500 missense probably damaging 1.00
R3413:Clvs2 UTSW 10 33622971 start gained probably benign
R4008:Clvs2 UTSW 10 33543462 missense probably damaging 1.00
R4855:Clvs2 UTSW 10 33622646 missense probably damaging 1.00
R5814:Clvs2 UTSW 10 33528507 missense probably benign 0.01
R6265:Clvs2 UTSW 10 33528515 missense possibly damaging 0.93
R6730:Clvs2 UTSW 10 33528521 missense probably damaging 1.00
R7558:Clvs2 UTSW 10 33543464 missense probably damaging 1.00
R7955:Clvs2 UTSW 10 33595812 missense possibly damaging 0.90
R8337:Clvs2 UTSW 10 33528488 missense possibly damaging 0.95
R8423:Clvs2 UTSW 10 33622859 missense possibly damaging 0.58
RF003:Clvs2 UTSW 10 33622925 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCAAGGGAGCCTACTCAAAGC -3'
(R):5'- GCTCGCCTGGAACTCAATGAGAAC -3'

Sequencing Primer
(F):5'- CTCAAAGCTCACTATGAGTTGC -3'
(R):5'- TCATCACTAGGCCGGACATTG -3'
Posted On2013-04-11