Incidental Mutation 'R0086:Olfr342'
ID19877
Institutional Source Beutler Lab
Gene Symbol Olfr342
Ensembl Gene ENSMUSG00000111869
Gene Nameolfactory receptor 342
SynonymsMOR136-4, GA_x6K02T2NLDC-33222024-33222962
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0086 (G1)
Quality Score218
Status Validated
Chromosome2
Chromosomal Location36524998-36530790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36527450 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 13 (I13F)
Ref Sequence ENSEMBL: ENSMUSP00000149751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074192] [ENSMUST00000216275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074192
AA Change: I13F

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073818
Gene: ENSMUSG00000111869
AA Change: I13F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-56 PFAM
Pfam:7tm_1 41 290 2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213794
Predicted Effect possibly damaging
Transcript: ENSMUST00000216275
AA Change: I13F

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Olfr342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr342 APN 2 36527993 missense probably benign 0.22
IGL01372:Olfr342 APN 2 36527451 missense probably benign 0.00
IGL01747:Olfr342 APN 2 36527832 missense probably damaging 1.00
IGL01836:Olfr342 APN 2 36527825 nonsense probably null
IGL02409:Olfr342 APN 2 36528153 missense probably damaging 1.00
IGL02578:Olfr342 APN 2 36528144 missense probably damaging 1.00
IGL03344:Olfr342 APN 2 36528128 missense probably damaging 1.00
IGL03396:Olfr342 APN 2 36527680 missense probably benign 0.00
R0427:Olfr342 UTSW 2 36527982 missense probably damaging 1.00
R0973:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R0973:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R0974:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R2183:Olfr342 UTSW 2 36527711 nonsense probably null
R2437:Olfr342 UTSW 2 36528246 missense probably damaging 1.00
R4060:Olfr342 UTSW 2 36527414 start codon destroyed probably null 0.01
R4982:Olfr342 UTSW 2 36527397 critical splice acceptor site probably null
R5070:Olfr342 UTSW 2 36527766 missense probably damaging 1.00
R6244:Olfr342 UTSW 2 36528341 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAACCATCACTAGCCCATTATTGTG -3'
(R):5'- ATTGCCTGAAGATAAGGCCCAAGAC -3'

Sequencing Primer
(F):5'- GCCCATTATTGTGACAAAAAGCTC -3'
(R):5'- GATGGCTACATACCTGTCATAGGC -3'
Posted On2013-04-11