Incidental Mutation 'R0086:Hoxd8'
ID19878
Institutional Source Beutler Lab
Gene Symbol Hoxd8
Ensembl Gene ENSMUSG00000027102
Gene Namehomeobox D8
SynonymsHox-4.3, 4921540P06Rik, Hox-5.4
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74704615-74707933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74705932 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 129 (G129W)
Ref Sequence ENSEMBL: ENSMUSP00000019749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019749] [ENSMUST00000074721] [ENSMUST00000151380]
Predicted Effect probably damaging
Transcript: ENSMUST00000019749
AA Change: G129W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019749
Gene: ENSMUSG00000027102
AA Change: G129W

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
HOX 195 257 1.69e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074721
AA Change: G129W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088094
Gene: ENSMUSG00000027102
AA Change: G129W

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
HOX 194 256 1.69e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145799
Predicted Effect probably benign
Transcript: ENSMUST00000151380
SMART Domains Protein: ENSMUSP00000118904
Gene: ENSMUSG00000027102

DomainStartEndE-ValueType
HOX 13 75 1.69e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198895
Meta Mutation Damage Score 0.2562 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. In addition to effects during embryogenesis, this particular gene may also play a role in adult urogenital tract function. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but show minor and low penetrance homeotic transformations in both lumbar (L1 to T13) and thoracic (T8 to T7) vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Hoxd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Hoxd8 APN 2 74706766 missense probably benign
IGL02675:Hoxd8 APN 2 74706586 missense probably damaging 1.00
IGL02801:Hoxd8 APN 2 74706568 missense probably damaging 1.00
R1944:Hoxd8 UTSW 2 74706712 missense probably damaging 1.00
R3848:Hoxd8 UTSW 2 74705585 missense possibly damaging 0.96
R3958:Hoxd8 UTSW 2 74706540 nonsense probably null
R6160:Hoxd8 UTSW 2 74705999 missense probably damaging 1.00
R7527:Hoxd8 UTSW 2 74705657 missense probably damaging 1.00
R8057:Hoxd8 UTSW 2 74704726 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTACGACTGTCATTTTGCACCCG -3'
(R):5'- CCTTGTGGTCTCATCCAGGGAAAC -3'

Sequencing Primer
(F):5'- ATTTTGCACCCGAGGTCAG -3'
(R):5'- GGTCTCATCCAGGGAAACATTTG -3'
Posted On2013-04-11